Rbpj (BC051387) Mouse Untagged Clone

CAT#: MC206648

Rbpj (untagged) - Mouse recombination signal binding protein for immunoglobulin kappa J region (cDNA clone MGC:54902, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Rbpj (BC051387) Mouse Untagged Clone
Symbol Rbpj
Synonyms RBP-J, CBF1, RBPjk, Igkjrb
Vector pCMV6-Kan/Neo
Sequence Data
>BC051387
GGCGGGGGGAATCTCGCGAGGGTTGGAGTTTTGGCGAGAGTTTGTGGAAGATGGCGCCTGTTGTGACAGG GAAGTTTGGTGAGCGGCCTCCACCCAAACGACTCACTAGGGAAGCTATGCGAAATTATTTAAAAGAACGA GGGGATCAAACAGTGCTCATTCTTCATGCAAAAGTTGCACAGAAGTCTTACGGAAATGAAAAACGATTTT TTTGCCCTCCTCCTTGTGTGTATCTTATGGGCAGTGGTTGGAAGAAAAAAAAAGAGCAAATGGAACGAGA TGGATGTTCTGAACAAGAGTCTCAACCCTGTGCGTTTATTGGAATAGGAAACAGTGACCAAGAAATGCAG CAGCTGAACTTGGAAGGGAAGAACTACTGCACAGCCAAAACATTGTACATATCTGATTCAGACAAGAGAA AACATTTCATGTTGTCTGTAAAGATGTTCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCG GATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCA GGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAG GAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTC GGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCA GTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAG ACGACCCTGTATCACAACTCCACAAATGTGCATTTTACCTTAAGGATACAGAAAGAATGTACTTGTGCCT TTCTCAAGAAAGAATAATCCAATTTCAGGCCACTCCATGTCCAAAAGAACAAAATAAGGAAATGATAAAC GATGGAGCTTCCTGGACAATCATTAGCACAGACAAGGCAGAATACACGTTCTATGAGGGAATGGGCCCCG TCCTTGCCCCAGTCACCCCTGTGCCTGTCGTAGAAAGTCTTCAGTTGAATGGCGGCGGGGACGTAGCAAT GCTTGAACTTACAGGACAAAACTTTACTCCAAATTTACGAGTGTGGTTTGGGGATGTAGAAGCCGAAACA ATGTACAGATGTGGAGAGAGCATGCTCTGTGTGGTCCCAGACATTTCTGCATTCCGGGAAGGTTGGAGAT GGGTCCGCCAGCCAGTCCAGGTTCCAGTGACTTTGGTCCGAAATGACGGGGTCATTTACTCCACCAGCCT TACCTTCACCTACACACCAGAGCCAGGGCCGAGGCCACACTGCAGCGCTGCAGGAGCGATTCTCAGAGCC AACTCCAGCCAAGTGCCCTCCAATGAGTCAAACACAAACAGCGAGGGGAATTACACAAATGCCAGCACAA ATTCTACCAGTGTCACATCGTCCACAGCAACCGTGGTGTCCTAACTACCGTCTTTTTGCTGGGACTGAAA CTGACTTGAATGCAGCAAAAAGTTGACAGAGAAAGGCAAGGATAAAGTGAACAATCTTTTGTGGTTTCTT GGGGAAACGTTTCGTACCAGGTGATCTATTCAAAACTGCCAGTGCAGGTGTGACATGCAGAGGCCACAGT ACAATGAACAACATCAGAATGCACAGGCTGATGGAAATCCAGGTTTTCAGCTGTCCCTCTCACACACACC CCTTTTTGGTTGTTTTGGTTTGGTTTTGATTTAATGGCCAGGAAACAGATATGTGGCTGGAGCACAGGCT AAGCTAGAAGACACAAACCTAACATAGACTTATGGACCAAGGGACTCGCATAAGCTTTAGTGAAAGGTAC ATTTTCACCATGCCTTTTTTATATCACAGTGTGTACTACACCTTGTTACCAAACAGGTTGCGCTCCCCAC CCTTTGAGGGTTGGCTCTAAAGTACATTCAGGTTCGAGCCTCACCATGTTTGTTCAGTCTGAACACTGAA CACTTCCAGGTTCTTGTGGTCTAAGGCTGGAACTTTTTTAAGCTGAAGTCTTATGACTTTTTCATAAGTT GGAATTATTTTGATTTCAGCAAGTCAAATTTTGTAAAGGCCTGCATATTTTTTTTAAGATTATATGAAGT CTGCAAAAGCTTTAAAAATGCCTCTGCCTTGCCTGCAATACATGCAATGTGTGTTAACTGAGTCTGTTCT CAGAATCTGTTGGTAGTTATTTCTGTGTTTTCCCTTTTTTTTAAAGAAATGTATTTATAGTGGTAATCTA AGAGATGCTAACAGCTCCGTGTGGCCATTTAGCCCTTTCTGAGTTCATGGCAGTGAGCACCGCCGTTCGA AGGCTATGCGCCTCTGCCTGTTCATCAGTTCATCTGTGTTCCAGGATTTGTTCAGGTTTCCCCTTCCCCC AAATCTTGTACATAACTTGTATTATGTGTAAGTTAAACATTTTATCTTTACTTGGAATGTTCCCAGTGAT TACATTTCACAGGGTGTTTCCCACCTTGTTGGCAAATGACAAAAAATATCATGCGAATTATTTGCTACCA AGATGGTGCCCGTAGGGTAAAATGAGGAACATCTCTGCAGGATGATTTATTGTATGTTTTCCTTTTTTTT AGCCTAGCCAGAACATCATTATAATTTTAAAGACCATAAGATGGCTTTTATTAGATGATAACTAAATAAA CTGAACTAAGTAGCCAGAAGACAGTACCTTAGAGACTGATAGTTGTAAGTTTATAAAAATACAAATGTAA CTTATATTTCCATTTTCCTCTTTGCCCCTTTGTTTATTTTCCCCAGTAGAAATGTTCTGTCCAGATTTTT TTTCCCCTTTTTAGTTAAGCCTTGCTTGCATTCAGGCTTGTGTGTCAGCCCTGTGTGCCAATATGCCAGA TTCATTTTGTTTCCATCCCTGCACTTTGGTTATTCCTCGTTCAGTTTCTTGGGAATTGAAGCAGACTCAT TGGGCTACATTTAGTACAAGAACCACATGTGTGATGTTAAAGGACACAGTCTAGTGATGCCATCATCCTT GAGTAAAAACTACCTCTAGATTGTGGTAAGCTTTTACTGTCCCTTAAAACAGGAGCCACTAGTACCTTAC GAATGCAGACTGTAACTTCTATGGCATTTTCTGGTGTCTTTCTGGCTCTCTGGGCTTCTGAAAGTTTTCA CGTAGACCCTTAGACTCCTCTGTCAGGACCATTGCTTTCCAGCGTTGCTGCTTTCACTCGCTGTCTCGCA GACTGTACCACTGTAAGTGCCACTGCGAACATCTTTAAACGGCCTCCTCCTTGGCTTGTCAAGGGGAAGG CCACCTGTAAGATGTGGTGGTGACAGCCTTCCTGTCCACCCCAGGCTGCTCCTTACCAGCTGTTCTAGCC GATTCTCTTCAGATCAGCTACAGCCCACCTCCTCCCCGCCCCGCCTCACCCCTCCAGGCTGTCTCAGTGG TCCAGGGCAGAGCTCACTGTGGCCTTACTGATCTATCTCTGCAGTAACTGTTCTCCCTCAGTTGCGATGG AAGCAGGCCCCTGCGATCTGTTCAGAGCCTGAGCAGTTTGCAGTTCCGTTGTGCTTTCTGAGGTCCTAGA TTCAGGATGTAGTTAAGTCGATAACTGAGAACAGATGAGATGCTTTTAAAGAACAAACTCTTCCTTACCC AGCTTTGTAGCTTAAAGTAAGTTTTCAAGTTCATGGCTTTATTAAAATGAACTTTGACTTTTTAAAATGC TTATATCTCATTTCGGTTCTTTTGTTTATTTTAGTAAGAATTGAAACAGACTATAAGTAGTTTTCCTGTT TGTTTGTTTGTTTGTTTTTTACAAAGTTCAAGAATGTAACAATAAAGGCATTTTGCTATGGTTCTATGTC AGACTCCTACCACAGAATAGTGTGAACAGATATGTCTGTCTGCTTTACCATGTTATTGATAGTTCTTTTG TCAGCTGCTTTTATTAAAAGTCCTCTTTTGTGGAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
Tag Tag Free
ACCN BC051387
ORF Size 1464 bp
Insert Size 1464
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC051387,
RefSeq Size 4038
RefSeq ORF 1464
Locus ID 19664
Cytogenetics 5 C1|5 29.37 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)