OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

2900010M23Rik (BC030629) Mouse Untagged Clone

Be the first to review this product
SKU
MC206545
2900010M23Rik (untagged) - Mouse RIKEN cDNA 2900010M23 gene (cDNA clone MGC:41028 IMAGE:1054665), (10ug)
Interest in protein/lysate? Submit request here!
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "2900010M23Rik or BC030629"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol 2900010M23Rik
Synonyms 2900010M23Rik; Cbp6; M19; Mnf1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030629
GGCAAGCGGGGCCCAAGATGGCCGCTCTCCGCTACCGGCGTTTCCTTAAGCTCTGTGAGGAATGGCCAGT GGACGAGACCAAACGGGGCCGGGACTTGGGCGCTTACCTGCGGCAGCGGGTAGCGCAGGCCTTCCGGGAG GGAGAGAACACCCAGATTGCAGAACCCGAGGCCTGTGATCAGATGTACGAGAGCTTAGCACGACTGCATT CAAACTACTACAAGCACAAGTACCCTCGCCCCAGAGACACCAGCTTCAGTGGCCTGTCCGTGGAAGAGTA CAAGCTGATCCTGTCCACAGACACTTTGGAAGAGTTCCAAGAGATGAATAAGAGCATGTGGAAGAAACTG CAGGAGAAGTTTGCGCCCACCAGGCCCGAGGAGAAGCACAAGGCCTGGACTCGGGTCCTGTCCCGCCCAC GGACCTGACCGTGGGGTCTGATACTCATCAATAAAACTGCCTGGTTTCTCCCACAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI |
ACCN BC030629
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030629, AAH30629
RefSeq Size 512 bp
RefSeq ORF 411 bp
Locus ID 67267
Cytogenetics 17 A3.3
Summary Required for the assembly of the ubiquinol-cytochrome c reductase complex (mitochondrial respiratory chain complex III or cytochrome b-c1 complex). Plays a role in the modulation of respiratory chain activities such as oxygen consumption and ATP production and via its modulation of the respiratory chain activity can regulate skeletal muscle differentiation and insulin secretion by pancreatic beta-cells. Involved in cytochrome b translation and/or stability.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products