Chchd4 (BC019405) Mouse Untagged Clone

CAT#: MC206531

Chchd4 (untagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 4 (cDNA clone MGC:30422 IMAGE:5066665), (10ug)


Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Chchd4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Chchd4
Synonyms 2410012P20Rik; 2810014D17Rik; AI838740
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019405
GGCGAGGGAGGTCACGGCGTGAAGGTGTATCCGCTCCAGCCGCGCCCGCTGCCTCTGCGAGCTGCAGAGG ACTGTCGGGAACAACCATGTCCTACTGCCGGCAGGAAGGGAAGGATCGGATCATATTTGTGACCAAAGAA GACCATGAAACTCCTAGCAGTGCCGAGCTGGTGGCTGATGACCCCAATGATCCCTATGAGGAGCACGGGT TGATACTGCCTAACGGAGATATTAACTGGAATTGTCCATGTCTTGGGGGAATGGCCAGCGGGCCCTGTGG GGAGCAGTTCAAGTCTGCCTTCTCCTGCTTCCACTACAGCACAGAGGATATCAAGGGATCAGACTGTATA GACCAGTTCCGGGCCATGCAAGAGTGCATGCAGAAGTACCCGGACCTCTATCCCCAAGACGAGGAGGAGG AAGAGGAGGCAAAGCCAGTGGAGCCGGTGGAGGAGACAGCTGACACTAAGGTCTCTGCAGCCAAAGAGCA GGGGACAAGCTCTTGAAGGCCACATGGCTGCCACTCACCATGGGACTTTCTGTACAATGCCTTTTGGTCA CCTTTGTGAAAGTTCTTTCCCTCTGTGCACTGTAATATACAAAATAACTTATTTTAATGATCAGGGGTCT TGGCCGTATACACTGAAGAAAAGGGCGTGTGTGCACCTGTGTCCTGCATAAACCTGTCCTTAAACATTAG TCCACTCCTGGATGTACTACTCTGTGATTGCCCTGGATTTTGCCACTTTGAAATAATGTGTTGAGACTTC TCAGCAACCAAAAGTTGTTACTCAGGAAAGTTTATCGTGAGAAAGCTGACCTATTCTGATCCATTTTGGT ATCCCTTTTGGTAGATTTTACACCTCTTTTGGAAATTAAGTAAATAGATGCCAAAACTCCTTTAAGAGTG GGTCCATTCCTACTGGAAGAGGCTGGTGGTCAGGTGCTTGCTGGAGTACATGGGGCTGCTGCCTCGTTCC CGACAGCTAATTGTCTGTTTGCTGTCCAGGCTCCAGTGCCTACAGCTGCAGGGTGGCATTGGATCCTGTG ACTCCCGGTCCTTCCTAAGTGAAAGGATGGGCTGGGTTTGCAGTTTATTGTTTTGCTGTTCTAAGAGCCC TGGTTTGGGGCCCATGTTCACTCAGTTGTGATATTGAGGTGGGGACCTAGCTGCTTCCAGAGCAGAAGCC AACAGAGGAATGTCTGAATGAAGTACTCAATTAAAAAGAAACAATTTCTATCTGAAAAAAAAAAAAAAAA A
Restriction Sites EcoRI-NotI     
ACCN BC019405
Insert Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC019405, AAH19405
RefSeq Size 1261 bp
RefSeq ORF 420 bp
Locus ID 72170
Cytogenetics 6 D1
Gene Summary Functions as chaperone and catalyzes the formation of disulfide bonds in substrate proteins, such as COX17, COX19 and MICU1. Required for the import and folding of small cysteine-containing proteins (small Tim) in the mitochondrial intermembrane space (IMS). Precursor proteins to be imported into the IMS are translocated in their reduced form into the mitochondria. The oxidized form of CHCHD4/MIA40 forms a transient intermolecular disulfide bridge with the reduced precursor protein, resulting in oxidation of the precursor protein that now contains an intramolecular disulfide bond and is able to undergo folding in the IMS. Reduced CHCHD4/MIA40 is then reoxidized by GFER/ERV1 via a disulfide relay system. Mediates formation of disulfide bond in MICU1 in the IMS, promoting formation of the MICU1-MICU2 heterodimer that regulates mitochondrial calcium uptake.[UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.