Rnf186 (BC011492) Mouse Untagged Clone
CAT#: MC206504
Rnf186 (untagged) - Mouse ring finger protein 186 (cDNA clone MGC:19106 IMAGE:4207836), (10ug)
Product Images
Frequently bought together (3)
Other products for "Rnf186"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rnf186 |
Synonyms | 9130020G10Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for BC011492, the custom clone sequence may differ by one or more nucleotides
ATGTCCTGCACTGAGGCCCCACAGCCTATCCCAGCGGGTACCACCACCACCAGCACCATCATTGCCTTGG GGCCCACCGGGCGGCTCAGCATCTCTGTGGAGGGTGACCTGGAATGCTTGGTGTGCCGAGAGCCCTACAA CTGTGCTCGGTCCCCCAAGCTGCTTAGCTGTCAGCATACCTTCTGTGCCGTATGCCTGAAGCTTCTGCTA TATGTGCAGGAAGACACCTGGTCCATCCCCTGTCCGCTGTGCCGAAAGGTCACTGCTGTCCCGGGAGGCC TCATCTGCAGCTTGCGAGACCAGGAGGCGATGGTGGGGCGTCTGGCCCTGCCATGCCCAGAGGTGCGCCT ATGTCCTCAGAGGCTAGTGGGTTCTGCCGCTTCAGCAACTCGGCCAGCCAACTGGACAGGAGAAGAAGAA CAGGACACTGTAAGTGTCAACCGTGTAGCTGCCCGGCGCCTGGCTGTACACTTGCTCTTGTTGGCTCTTG TCATTGTCCTTATCCTGCCTTTCATCTACCCGGGTGTCATCCGGTGGGTGTTGGCCTTTGTCATTGCTCT GGCTCTCCTGATGTCCACCCTATTCTGCTGTCACCCCCAGAGCCAGAACAGCAACTGGCTTTGCCCCAGG ACTCTGTTCTGCAGAGAGCAAAAGCAAACCCAGATCACTTCTATTGCCTGA |
Restriction Sites | EcoRI-NotI |
ACCN | BC011492 |
Insert Size | 681 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC011492, AAH11492 |
RefSeq Size | 1237 bp |
RefSeq ORF | 681 bp |
Locus ID | 66825 |
Cytogenetics | 4 D3 |
Gene Summary | E3 ubiquitin protein ligase that is part of an apoptotic signaling pathway activated by endoplasmic reticulum stress. In that process, stimulates the expression of proteins specific of the unfolded protein response (UPR), ubiquitinates BNIP1 and regulates its localization to the mitochondrion and induces calcium release from the endoplasmic reticulum that ultimately leads to cell apoptosis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.