Rnf186 (BC011492) Mouse Untagged Clone

SKU
MC206504
Rnf186 (untagged) - Mouse ring finger protein 186 (cDNA clone MGC:19106 IMAGE:4207836), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rnf186
Synonyms 9130020G10Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC011492, the custom clone sequence may differ by one or more nucleotides


ATGTCCTGCACTGAGGCCCCACAGCCTATCCCAGCGGGTACCACCACCACCAGCACCATCATTGCCTTGG
GGCCCACCGGGCGGCTCAGCATCTCTGTGGAGGGTGACCTGGAATGCTTGGTGTGCCGAGAGCCCTACAA
CTGTGCTCGGTCCCCCAAGCTGCTTAGCTGTCAGCATACCTTCTGTGCCGTATGCCTGAAGCTTCTGCTA
TATGTGCAGGAAGACACCTGGTCCATCCCCTGTCCGCTGTGCCGAAAGGTCACTGCTGTCCCGGGAGGCC
TCATCTGCAGCTTGCGAGACCAGGAGGCGATGGTGGGGCGTCTGGCCCTGCCATGCCCAGAGGTGCGCCT
ATGTCCTCAGAGGCTAGTGGGTTCTGCCGCTTCAGCAACTCGGCCAGCCAACTGGACAGGAGAAGAAGAA
CAGGACACTGTAAGTGTCAACCGTGTAGCTGCCCGGCGCCTGGCTGTACACTTGCTCTTGTTGGCTCTTG
TCATTGTCCTTATCCTGCCTTTCATCTACCCGGGTGTCATCCGGTGGGTGTTGGCCTTTGTCATTGCTCT
GGCTCTCCTGATGTCCACCCTATTCTGCTGTCACCCCCAGAGCCAGAACAGCAACTGGCTTTGCCCCAGG
ACTCTGTTCTGCAGAGAGCAAAAGCAAACCCAGATCACTTCTATTGCCTGA


Restriction Sites EcoRI-NotI |
ACCN BC011492
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC011492, AAH11492
RefSeq Size 1237 bp
RefSeq ORF 681 bp
Locus ID 66825
Cytogenetics 4 D3
Summary E3 ubiquitin protein ligase that is part of an apoptotic signaling pathway activated by endoplasmic reticulum stress. In that process, stimulates the expression of proteins specific of the unfolded protein response (UPR), ubiquitinates BNIP1 and regulates its localization to the mitochondrion and induces calcium release from the endoplasmic reticulum that ultimately leads to cell apoptosis.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products