Sf3b5 (BC006603) Mouse Untagged Clone

CAT#: MC206491

Sf3b5 (untagged) - Mouse splicing factor 3b, subunit 5 (cDNA clone MGC:11596 IMAGE:3965951), (10ug)


Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sf3b5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sf3b5
Synonyms 10kDa, Sf3b10
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC006603
AGACTGTCTACTCCTGCGTCTCGGTGGCGTCTTTCTCCCGCGCCTGCACGAACTGAGGTTTTGCGTGGCG GCGGCGGCACCGGCAGCGGCAGCGTCTCTCACTTGAACGCCGCGAGCGGCAGCTTCTCGTCTGTGTCCTG ACCTCGGAGCCTACGAGCAGAGCGGCGCGATGACGGACCGGTACACCATCCACAGCCAGCTGGAGCATCT GCAGTCCAAGTACATCGGCACGGGCCACGCCGACACCACCAAGTGGGAATGGCTGGTGAACCAGCACCGC GACTCCTACTGCTCCTACATGGGCCACTTCGACCTCCTCAACTACTTCGCCATTGCCGAGAACGAGAGCA AAGCCCGCGTGCGGTTCAACCTGATGGAGAAAATGCTGCAGCCCAGCGGGCCGCCCGCGGACAAGCCCGA GGAGAACTGAGGCGAGCGCTGCCCAGTCTTCCCCGTGTGCCGGCTGCGAGCCTCCTTGCTCCTGCATCTC GACCATTCCGTGTTGGCTGTATCGCCTGACCTGCGTACCTGTGGAGGATTCGGAACAAGTCATGGAGAGA CTGTCCGGGTCCGCTCCTTGTGAACTGTGCAGAAGGAGTGATCCCAGCATCGGCAAGCGAGGGAGAAGAC TGCACGAGAGTGATGGCGCATTTCGAGTCTGCTTTTCGATAGTTGATGTCTTCTTGCCTTTTTAAAAAAC CACATATATATAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN BC006603
Insert Size 261 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC006603, AAH06603
RefSeq Size 727 bp
RefSeq ORF 261 bp
Locus ID 66125
Cytogenetics 10 A2
Gene Summary Involved in pre-mRNA splicing as a component of the splicing factor SF3B complex, a constituent of the spliceosome. SF3B complex is required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence (BPS) in pre-mRNA. Sequence independent binding of SF3A/SF3B complex upstream of the branch site is essential, it may anchor U2 snRNP to the pre-mRNA.[UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.