OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

1810019J16Rik (BC006890) Mouse Untagged Clone

Be the first to review this product
SKU
MC206476
1810019J16Rik (untagged) - Mouse RIKEN cDNA 1810019J16 gene (cDNA clone MGC:11921 IMAGE:3599314), (10ug)
Interest in protein/lysate? Submit request here!
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA334110 Rabbit Polyclonal Anti-1810019J16Rik Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "1810019J16Rik or BC006890"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol 1810019J16Rik
Synonyms 1810019J16Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC006890, the custom clone sequence may differ by one or more nucleotides


ATGAGCGCTCCCAGCCCCCACCGGGCCGTCGCACCAGGAGGCCAGACCCTAAGGACCCTGGCCACCATGG
GCCAGAGAGTATCACCTTCATTTCAGGCTCTGCAGAACCAGCCAACGAGCCCCCAACCTGCTGCCTCCTC
TGGCGCCCCTGGGGTTGGGACTGGTGTAGGGCTGCCTTCTGCTTCCGCCGCTGCAGGGATTGCCTGCAGC
GCTGTGGGGCTTGTGTGCGGGGCTGCAGCCCCTGCTTATCTGCCGGAGACCCCATTGAAGGGTCTGCCGA
AGCCGCCTGGGCCAAGGAACACAATGGTGTGCCCCCCAGCCCGGACCGTGCACCCCCCAGCCGCCGGGAT
GGCCAGAGGCTCAAGACCAGCATGGGCAGCAGCTTCAGCTACCCTGATGTTAAGCTCAAAGGCATCCCTG
TCTACCCCTACCGCCATGCCACCTCCCCAGTCCCTGACGTGGACTCCTGCTGCAAGGAGCCCCTGGCCGA
GCCTCCTCCCACACGGCACAGCTTGCCTAGCACCTTCACCAACAGCCCCCGCGGCTCTGAGGAGTACTAC
TCCTTCCATGAATCGGACCTGGACCTGCCTGAGATGGGCAGTGGCTCCATGTCGAGCCGGGAGATCGACG
TGCTTATTTTCAAGAAGCTGA
Restriction Sites EcoRI-NotI |
ACCN BC006890
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC006890, AAH06890
RefSeq Size 1680 bp
RefSeq ORF 651 bp
Locus ID 69073
Cytogenetics 4 D2.3
Summary Plays a role in the regulation of the epidermis formation during early development. Required both as an inhibitor of basal cell proliferation and a promoter of differentiation of basal progenitor cell progeny.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products