2310035K24Rik (BC048399) Mouse Untagged Clone

CAT#: MC206399

Reviews ()
Write a review

2310035K24Rik (untagged) - Mouse RIKEN cDNA 2310035K24 gene (cDNA clone MGC:56996 IMAGE:6438951), (10ug)

  View "BC048399" in other vectors (1)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name 2310035K24Rik (BC048399) Mouse Untagged Clone
Symbol 2310035K24Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC048399
GTCAAAGTCTGCAAATCTAGGTTCCCTTCCTGAAGCGGGCTTGCTAAATTTCCTGTTGGGTAACTTTGAA TTCTTGGTCTGTTTAGCTTTAGCTGTGGCTAAACACTGTTTCTCCTCAGCCTTGAGACCGGGGGCTGCCA CTCTCGCTTTGCCCAGAGCGGCCAGGCTCTCTCTCTGTGTATCTGTGGCTGACTTGAATTCCTGATTCTC TTGCCTCCGCCTCCCGAGGGTTGGGATTTCAGGTCTCTGGCTTTCCTGGAGCACCCACCCTGGAGCTATG GTCCACGCTTTCCTCATCCACACTCTGAGGGCCCCGAATTTGGAAGATACAGGCCTTTGCCGAGTGCTCT ATTCCTGTGTCTTTGGTGCTGAGAAATCACCCGATGATCCACGGTCACATGGTGCAGAAAGGGACAGGCT CTTCCGCAAGGAACAGATTTTGGCAGTGGCCAGACAGGTGGAGTCACTGTGTAGGCTGCAGCAGCAAGCG GCTGGATGTTCCTCCACAGACCTTCAGCCTCAGTTCTCAGCTGAACCTGTGTCCCTGCATGAGGCCCCTC ATGGAGCCTTCCACCTGGCAGCCGGGGACCCTTTCCAGGAGCCTCGGACAGTGCTATGGCTGGGTATACT CTCCTTAGGTTTCGCCCTGGTGTTGGACACCCATGAGAACCTGCTGCTGGCTGAGCGCACGCTCCGGCTC TTGGCTCGCCTCCTCCTTGACCACCTCCGGCTGCTGACACCAGTTTGTCCAGGATCTGGAGAAGGAATTC AGTGCTGCTTGGCCCCGCTGACCCCTCACCAGACAAAGAGCGAGGGTAAAGGTTGCATACTGCTAGGGGA AGTGTGGCATCTGCCTCTTGCCCAGCCTGCTCCCTGCTCTGATGTGTGGCCACGCTCAGGACATACGGAT TGGGCAAGCCCGAAGGAAGGGACCTGGGTAGAAGGCTGTCTGTGCCTGTCCTCAGGCCACTGGAATTGTA AAGTATTCATTGTAGAGCATCCTGAAGCTGGAACCGCCCCGTGATCGCGTAGGCTCTACAGTGTCCACCA CGCGAGTCTTTGACTCCTCTTCATTCAACCCTACCAGCTGTCAGCACTGGAGCAGCATACTGCCGAGCTC ACCCTAGTCGATAGCCCCAGCACAAAAGGAGCCTCTGAGACCCACTTCACGGCTGGAGAACTGGGCTGGT ACCCTAGCAAGCCCCGGTCCCTGCCTTTGCTCATCAGCAAGGATTTTGTCGGCAAGGCCTGTTCTGCTTC TAGCTCCCCCACAGTGCAGAGCAGGGGGATTCTGCGGTTCCTTATGTGCCATGCCCCCGTGTCTGCCAAG AGAGCTGAGAACACAACAGCTTTTCTTGTCTGCTGGCTGGCAGGGGCCAGGCGTCTGGCCCAGGTGATGC CTTATTTTGAATTAAAAACAATGGCGGTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC048399
ORF Size 747 bp
Insert Size 747
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC048399
RefSeq Size 1568
RefSeq ORF 747
Locus ID 69596
Cytogenetics 2 F1

Other Versions

Other products for "2310035K24Rik"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones