Abcd2 (BC019187) Mouse Untagged Clone

CAT#: MC206353

Abcd2 (untagged) - Mouse ATP-binding cassette, sub-family D (ALD), member 2 (cDNA clone MGC:29110 IMAGE:5027149), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abcd2 (BC019187) Mouse Untagged Clone
Symbol Abcd2
Synonyms ALDR, ABC39, ALDL1, ALDRP
Vector pCMV6-Kan/Neo
Sequence Data
>BC019187
CCACGCGTCCGTAAGAGTAAAGGAGACAAGCTGCAGAGCATGGGAGGCTGTGGGGTCTTCTGAAACCTTT GCTGGGCTTTCCGCGGAGCATGAGCTTTTAAAACGAATTCTTTTCAAAGAAACCCATTTGTGTAGCTGGA AAAATGATACACATGCTAAATGCAGCAGCCTATCGGGTGAAATGGACCAGATCCGGTGCTGCTAAAAGGG CTGCCTGCCTGGTGGCTGCGGCATATGCTCTGAAAACCCTCTATCCCATCATTGGCAAGCGTTTAAAGCA GCCTGGCCACAGGAAGGCAAAAGCAGAAGCTTACTCGCCTGCAGAGAACAGAGAAATACTGCATTGCACG GAGATCATCTGTAAAAAACCTGCGCCGGGACTAAATGCAGCTTTTTTCAAACAGCTACTAGAACTTCGGA AAATCCTCTTTCCAAAACTTGTGACCACTGAAACGGGGTGGCTCTGCCTCCACTCGGTGGCTCTAATCTC AAGAACATTTCTCTCTATTTATGTGGCTGGTCTGGATGGGAAAATCGTGAAAAGCATCGTGGAAAAGAAG CCTCGGACTTTCATCATCAAATTAATCAAGTGGCTTATGATTGCTATCCCTGCTACCTTTGTCAACAGTG CTATCAGGTACCTGGAATGCAAACTGGCATTGGCCTTTAGAACTCGCTTAGTAGACCATGCCTATGAGAC CTATTTCGCAAATCAGACTTATTATAAGGTGATAAATATGGATGGGAGGCTGGCAAACCCTGACCAGTCT CTTACCGAAGACATTATGATGTTCTCGCAATCTGTGGCTCACCTGTATTCCAACCTTACCAAACCTATTT TAGATGTCATTCTAACCTCCTATACTCTCATCCGGACAGCTACATCCAGAGGAGCAAGCCCTATAGGGCC CACCCTGTTAGCAGGACTTGTCGTGTATGCCACTGCTAAAGTACTGAAAGCTTGCTCGCCCAAATTTGGT TCGCTGGTGGCTGAAGAAGCCCACAGGAAAGGCTACCTGCGGTATGTCCACTCCCGAATCATAGCCAATG TAGAAGAAATTGCCTTCTACAGAGGACATAAGGTAGAAATGAAGCAGCTGCAGAAATGTTACAAGGCTTT AGCTTACCAGATGAACCTGATTTTATCCAAACGTTTATGGTACATCATGATAGAACAATTCTTGATGAAG TATGTGTGGAGCAGCTGTGGACTAATTATGGTGGCTATACCCATTATCACTGCAACGGGCTTTGCAGATG GTGATCTGGAGGATGGTCCAAAGCAGGCTATGGTTAGCGATCGGACAGAGGCCTTCACCACTGCCCGGAA CTTACTGGCCTCTGGAGCTGATGCAATTGAAAGGATTATGTCTTCATACAAAGAGATCACTGAACTAGCA GGTTATACTGCTAGAGTATACAATATGTTCTGGGTCTTCGATGAAGTGAAGAGAGGCATTTATAAGAGAA CTGTCACTCAGGAACCTGAAAACCATAGCAAGCGTGGAGGTAACCTGGAACTACCCCTCAGCGACACCCT GGCCATCAAAGGAACAGTTATTGATGTGGATCATGGAATCATTTGTGAAAATGTTCCCATAATTACACCA GCGGGCGAAGTGGTGGCTTCCAGGCTAAACTTCAAAGTGGAAGAAGGGATGCATCTCTTGATAACTGGTC CCAACGGTTGTGGGAAAAGCTCTCTCTTCAGAATCTTAAGCGGGCTGTGGCCTGTGTATGAAGGAGTCCT TTATAAACCGCCTCCCCAACATATGTTCTATATTCCACAGAGGCCATACATGTCTCTTGGAAGTCTCCGG GATCAAGTCATTTACCCTGACTCAGCGGATGACATGCGTGAGAAAGGTTACACTGACCAAGACCTAGAAC GCATCCTGCACAGCGTGCACCTCTACCACATAGTTCAAAGAGAAGGAGGATGGGATGCAGTCATGGACTG GAAAGATGTCCTTTCCGGAGGGGAGAAGCAGAGAATGGGCATGGCGCGGATGTTTTACCATAAACCGAAG TATGCATTGCTGGATGAATGTACCAGTGCCGTGAGCATCGACGTTGAAGGAAAGATATTTCAGGCTGCTA TTGGGGCTGGGATTTCCCTACTCTCCATAACACACAGGCCTTCTCTGTGGAAATACCACACTCATCTATT ACAATTCGATGGCGAAGGAGGCTGGCGCTTTGAACAGTTGGACACTGCTATCCGTTTAACGTTGAGTGAG GAAAAGCAAAAGTTGGAGTCGCAGCTCGCTGGAATTCCCAAAATGCAACAGAGACTCAACGAACTATGCA AAATTCTGGGGGAAGACTCGGTGCTGAAAACAATCCAAACTCCAGAAAAGACATCCTAATTTATCTTGAC ATGTTTTCAGTTACCTTCTAGGTGAAGCCTCAGAGACTCTCTCTTTACTGCATGCAGTATGTTAAGCTAA GTGCAGAGAAAGCAAGCCGGCAAAAAAAAAGTATTTTGTATGATTTTAGCATCGAGGAAATATATGAAGA CTTTTCAAACAAACAAACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC019187
ORF Size 2226 bp
Insert Size 2226
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC019187,
RefSeq Size 2553
RefSeq ORF 2226
Locus ID 26874
Cytogenetics 15|15 E3
Gene Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.