Tbl3 (BC019504) Mouse Untagged Clone

CAT#: MC206326

Tbl3 (untagged) - Mouse transducin (beta)-like 3 (cDNA clone MGC:28734 IMAGE:4460615), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbl3 (BC019504) Mouse Untagged Clone
Symbol Tbl3
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC019504
CGGGGAGAAAGGCTGCTGAACTTGGAGGCGCTGCCCTGGGACATGGCCGAGACTGCGGCGGGATTGTGCC GCTTCAAAGCCAACTATGCTGTTGAGCGAAAGATTGAACCTTTCTACAAGGGTGGGAAAGCACAGCTGGA CCAGACTGGCCATTACCTCTTCTGTGTCTGTGGTACCAAAGTTAACATCCTGGATGTGGCCTCAGGGGCT TTGCTTCGGAGCCTGGAGCAGGAGGACCAAGAGGACATTACCTCCTTTGACCTCAGTCCTGATGATGAAG TACTCGTAACAGCCAGCCGCGCACTGCTGCTGGCTCAGTGGGCCTGGCGGGAAGGCACTGTCACTCGCCT GTGGAAGGCGATACACACAGCTCCTGTGGCCTCCATGGCTTTTGATGCCACCTCTACACTGTTAGCCACA GGCGGCTGTGATGGGGCTGTACGTGTTTGGGACATTGTGCAACATTACGGGACACACCACTTTCGAGGCT CACCTGGTGTGGTGCATTTGGTGGCCTTCCATCCAGACCCCACCCGCCTGCTGCTCTTCTCCTCAGCTGT GGACACCTCTATCCGCGTGTGGTCACTGCAGGACCGCTCGTGTTTGGCTGTCCTGACTGCACACTATAGT GCTGTCACTTCTCTGTCCTTTAGTGAGGGTGGCCACACTATGCTCAGTTCTGGCCGTGACAAGATCTGCA TAGTTTGGGACCTTCAGAGCTACCAGACTACAAGGACGGTGCCAGTGTTTGAGAGCGTGGAAGCCTCTGT GCTGCTGCCCGAACAGCCGGCACCTGCGCTGGGTGTGAAGAGCTCAGGCCTGCACTTCTTAACAGCTGGT GACCAAGGGATCCTTCGTGTGTGGGAGGCTGCTTCTGGGCAGTGTGTATACACCCAGCCACAAATGCCAG GCCTACGGCAGGAACTGACCCACTGTACCCTGGCCCGTGCTGCTGACCTGCTCCTCACTGTCACTGCCGA TCACAACCTGCTCCTCTATGAGGCACACTCCTTACAGTTGCAGAAACAGTTTGCTGGCTATAGTGAGGAA GTATTGGATGTTCGCTTCCTGGGGCCCAGTGACTCCCACATCGTCGTGGCTTCCAACAGCCCTTGCCTGA AGGTGTTTGAGCTGCAGACTTTGGCCTGTCAGATCCTCCATGGTCACACAGACATTGTCTTGGCCCTGGA TGTGTTCCGGAAGGGGTGGCTCTTTGCTAGCTGTGCCAAGGATCAGAGCATACGCATCTGGAAGATGAAC AAGGCTGGCCAGGTGGCCTGTGTAGCTCAGGGTTCTGGCCACACACATAGTGTGGGCACCATCTGCTGTT CTAGGCTAAAAGAATCTTTCCTGGTGACTGGCAGTCAGGACTGTACTGTGAAGCTCTGGCCCCTCCCTGA AGCTCTGCTGGCCAACAAGAGCACAGCTGCAGACAGTGGCCCCGTGCTTCTACAAGCCCAGACCACTCAG CGATGCCACGACAAAGACATCAACAGTTTGGCTGTCTCCCCCAATGACAAGCTGTTAGCAACAGGCTCAC AGGATCGCACAGCTAAGCTCTGGGCCTTGCCTCAGTGCCAACTGTTAGGTGTTTTTACAGGCCACCGACG TGGCCTCTGGAATGTCCAGTTCTCACCTACGGACCAGGTGCTGGCCACAGCCTCTGCTGATGGTACCATC AAGCTCTGGGCACTGCAGGACTTCAGTTGTCTCAAGACATTTGAGGGACACGATGCTTCTGTACTGAAGG TGGCCTTTGTAAGCCGTGGCTCACAGCTGCTGTCTAGTGGCTCTGATGGGCTCCTGAAGCTGTGGACCAT TAAGAGCAACGAGTGTGTGCGGACCCTGGATGCTCACGAGGACAAGGTCTGGGGACTACACTGCAGCCAA CTGGATGATCATGCCATCACCGGTGGCAGTGACTCCCGAATCATTCTCTGGAAGGATGTGACAGAAGCTG AGCAGGCAGAAGAGCAGGCCAAACGGGAAGAGCAGGTGATCAAGCAGCAAGAACTGGACAACCTGCTCCA TGAGAAGCGGTATCTCCGGGCACTAGGCCTTGCCATCTCTCTGGATCGTCCCCACACTGTGCTGACCGTT ATCCAGGCCATCCGGAGAGATCCTGAGGCCTGTGAGAAGCTGGAAGCCACTGTACTCCGACTGCGAAGAG ACCAGAAAGAGGCCCTGCTGCGCTTCTGTGTCACGTGGAACACAAACTCCAGACATTGCCACGAAGCCCA GGCTGTGCTTGGTGTGCTGCTGCGGCACGAGGCTCCTGAGGAGCTGCTGGCCTACGACGGGGTGCGGGGG TCACTGGAGGCCTTGCTGCCCTACACTGAGCGGCACTTTCAGCGGCTTAGCAGGACACTGCAAGCAGCCA CCTTCTTGGACTTCCTGTGGCACAACATGAAGCTGTCCCCATGCCCTGCTGCAGTTCCCCCAGCCCTATG AAACAGAAAAGTTAACTTTCTAACTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC019504
ORF Size 2409 bp
Insert Size 2409
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC019504,
RefSeq Size 2506
RefSeq ORF 2409
Locus ID 213773
Cytogenetics 17|17 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.