Tbl3 (BC019504) Mouse Untagged Clone

CAT#: MC206326

Reviews ()
Write a review

Tbl3 (untagged) - Mouse transducin (beta)-like 3 (cDNA clone MGC:28734 IMAGE:4460615), (10ug)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Tbl3 (BC019504) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tbl3
Synonyms 9430070M15Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC019504
CGGGGAGAAAGGCTGCTGAACTTGGAGGCGCTGCCCTGGGACATGGCCGAGACTGCGGCGGGATTGTGCC GCTTCAAAGCCAACTATGCTGTTGAGCGAAAGATTGAACCTTTCTACAAGGGTGGGAAAGCACAGCTGGA CCAGACTGGCCATTACCTCTTCTGTGTCTGTGGTACCAAAGTTAACATCCTGGATGTGGCCTCAGGGGCT TTGCTTCGGAGCCTGGAGCAGGAGGACCAAGAGGACATTACCTCCTTTGACCTCAGTCCTGATGATGAAG TACTCGTAACAGCCAGCCGCGCACTGCTGCTGGCTCAGTGGGCCTGGCGGGAAGGCACTGTCACTCGCCT GTGGAAGGCGATACACACAGCTCCTGTGGCCTCCATGGCTTTTGATGCCACCTCTACACTGTTAGCCACA GGCGGCTGTGATGGGGCTGTACGTGTTTGGGACATTGTGCAACATTACGGGACACACCACTTTCGAGGCT CACCTGGTGTGGTGCATTTGGTGGCCTTCCATCCAGACCCCACCCGCCTGCTGCTCTTCTCCTCAGCTGT GGACACCTCTATCCGCGTGTGGTCACTGCAGGACCGCTCGTGTTTGGCTGTCCTGACTGCACACTATAGT GCTGTCACTTCTCTGTCCTTTAGTGAGGGTGGCCACACTATGCTCAGTTCTGGCCGTGACAAGATCTGCA TAGTTTGGGACCTTCAGAGCTACCAGACTACAAGGACGGTGCCAGTGTTTGAGAGCGTGGAAGCCTCTGT GCTGCTGCCCGAACAGCCGGCACCTGCGCTGGGTGTGAAGAGCTCAGGCCTGCACTTCTTAACAGCTGGT GACCAAGGGATCCTTCGTGTGTGGGAGGCTGCTTCTGGGCAGTGTGTATACACCCAGCCACAAATGCCAG GCCTACGGCAGGAACTGACCCACTGTACCCTGGCCCGTGCTGCTGACCTGCTCCTCACTGTCACTGCCGA TCACAACCTGCTCCTCTATGAGGCACACTCCTTACAGTTGCAGAAACAGTTTGCTGGCTATAGTGAGGAA GTATTGGATGTTCGCTTCCTGGGGCCCAGTGACTCCCACATCGTCGTGGCTTCCAACAGCCCTTGCCTGA AGGTGTTTGAGCTGCAGACTTTGGCCTGTCAGATCCTCCATGGTCACACAGACATTGTCTTGGCCCTGGA TGTGTTCCGGAAGGGGTGGCTCTTTGCTAGCTGTGCCAAGGATCAGAGCATACGCATCTGGAAGATGAAC AAGGCTGGCCAGGTGGCCTGTGTAGCTCAGGGTTCTGGCCACACACATAGTGTGGGCACCATCTGCTGTT CTAGGCTAAAAGAATCTTTCCTGGTGACTGGCAGTCAGGACTGTACTGTGAAGCTCTGGCCCCTCCCTGA AGCTCTGCTGGCCAACAAGAGCACAGCTGCAGACAGTGGCCCCGTGCTTCTACAAGCCCAGACCACTCAG CGATGCCACGACAAAGACATCAACAGTTTGGCTGTCTCCCCCAATGACAAGCTGTTAGCAACAGGCTCAC AGGATCGCACAGCTAAGCTCTGGGCCTTGCCTCAGTGCCAACTGTTAGGTGTTTTTACAGGCCACCGACG TGGCCTCTGGAATGTCCAGTTCTCACCTACGGACCAGGTGCTGGCCACAGCCTCTGCTGATGGTACCATC AAGCTCTGGGCACTGCAGGACTTCAGTTGTCTCAAGACATTTGAGGGACACGATGCTTCTGTACTGAAGG TGGCCTTTGTAAGCCGTGGCTCACAGCTGCTGTCTAGTGGCTCTGATGGGCTCCTGAAGCTGTGGACCAT TAAGAGCAACGAGTGTGTGCGGACCCTGGATGCTCACGAGGACAAGGTCTGGGGACTACACTGCAGCCAA CTGGATGATCATGCCATCACCGGTGGCAGTGACTCCCGAATCATTCTCTGGAAGGATGTGACAGAAGCTG AGCAGGCAGAAGAGCAGGCCAAACGGGAAGAGCAGGTGATCAAGCAGCAAGAACTGGACAACCTGCTCCA TGAGAAGCGGTATCTCCGGGCACTAGGCCTTGCCATCTCTCTGGATCGTCCCCACACTGTGCTGACCGTT ATCCAGGCCATCCGGAGAGATCCTGAGGCCTGTGAGAAGCTGGAAGCCACTGTACTCCGACTGCGAAGAG ACCAGAAAGAGGCCCTGCTGCGCTTCTGTGTCACGTGGAACACAAACTCCAGACATTGCCACGAAGCCCA GGCTGTGCTTGGTGTGCTGCTGCGGCACGAGGCTCCTGAGGAGCTGCTGGCCTACGACGGGGTGCGGGGG TCACTGGAGGCCTTGCTGCCCTACACTGAGCGGCACTTTCAGCGGCTTAGCAGGACACTGCAAGCAGCCA CCTTCTTGGACTTCCTGTGGCACAACATGAAGCTGTCCCCATGCCCTGCTGCAGTTCCCCCAGCCCTATG AAACAGAAAAGTTAACTTTCTAACTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC019504
ORF Size 2409 bp
Insert Size 2409
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC019504, AAH19504
RefSeq Size 2506
RefSeq ORF 2409
Locus ID 213773
Cytogenetics 17 A3.3
Other products for "Tbl3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones