Tmem33 (BC016570) Mouse Untagged Clone

CAT#: MC206303

Tmem33 (untagged) - Mouse transmembrane protein 33 (cDNA clone MGC:29024 IMAGE:3583937), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem33 (BC016570) Mouse Untagged Clone
Symbol Tmem33
Synonyms db83
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC016570
TGCACGCGTCCGGGAGGGCCCGTTCCTCCGGGGGTTTGGGGTTCCTGCCGGCTCTGAAAGCAGGTCGGAG GGTCGTCGCCCCGCACTGACGTTTTGCTCTTCTTTGCTGTTGCAGCGTCCCGGGCTCCCGAGTGTCTCCC ATGGCGGATACGACCCCGAACGGCCCCCAAGGGGCGGGCGCTGTGCAATTCATGATGACCAATAAATTGG ACACAGCAATGTGGCTTTCTCGCCTGTTCACAGTTTATTGCTCCGCTCTGTTCGTTCTGCCTCTTCTTGG GTTGCATGAAGCAGCGAGCTTTTACCAGCGTGCTTTGCTGGCCAATGCTCTGACCAGCGCTCTGAGGCTG CATCAGAGATTACCTCACTTCCAGTTGAGCAGAGCGTTCCTGGCTCAGGCCTTGTTAGAGGACAGCTGCC ACTACCTGCTGTATTCACTCATCTTCGTCAACTCCTACCCTGTCACAATGAGTATTTTTCCAGTCTTGTT ATTTTCTTTGCTCCATGCTGCCACATACACTAAGAAGGTCCTGGACGCAAAGGGTTCAAATAGTTTACCT CTGTTGAGATCATTCTTGGATAAATTAAGTACTAACCAACAAAATATTCTGAAATTCATCGCTTGTAATG AAATATTCTTGATGCCTGCTACAGTTTTTATGCTCTTTAGTGGCCAAGGAAGTTTGCTCCAGCCTTTTAT ATATTATAGATTTCTTACTCTTCGATATTCCTCTAGAAGAAATCCATATTGTCGGAACTTGTTTAATGAA CTGAGGATTGTGGTTGAACACATTATTATGAAGCCCTCCTGCCCACTGTTTGTGAGAAGACTATGTCTCC AGAGCATCGCCTTTATCAGCAGACTGGCACCAACAGTTGCGTAGTTTAACATCTAGTTAAGCTGTGTTTA GAAGATTAGCATTATTAGCTGGTAATTCTGATAGGGGTCCCAAATTACAGGTCTAACACTGACCTCAGTC CAATTTACATGATTTACATAAATGCATCTCAGTGCAAAAATAATAATTTTCCTGGCATGTTAAATCAAGC CTTTAACACTTTCTGAGAAAATTTTACTGTACATTACTGTTTGTGGTTATGTAAGTTTGTATTTAGTGAT AAATGTTACTAAATTGTTTTAGATGCTGCTGTGCCTACATCATGAAATACATTTATTTCTTTTAAAAAGA ATTCTGAAATTTGTTTTACCCTAACTATTAACCCACGTTATGTCTGTTGTGAGTTATGGTACTAGATGAG TTGAGTATGTTTGGAGACAGTGGTTTTCCATTCTGTAAGTTGGGTTGAGATTTTAGCAGAAGCACACCTC CTGCAGTTTCAGTTCACACGCTACTATGCTGCTTTCTAGGGCAGGTGTGTTTAGCCTGCACCATAACAGA GAAGTCTGTCTGCGTCTTATGACCTGTGAAGCTGTTGTTCCCATAGTGCATCTGTGGCTTTGAATGATGT TTGAAAAATGGATTGCCTGTACACCTATTTTGAATTAGATCTTTGGGGCCATGTAATCATTTACTGTAGA AGACAGTAGTGACACAGAGACCTACTGACTAACTTTTATAAATGTCAACCAGTAGATTATCAGTGTTCCT ATAGTTTGTAGGATTACATAGTTCCAGAATCTTGACTTTAGTTTTCTTGGTTTCTTAGGCTTGAAATTTC CTAGCCATGTGCAGCAGCAGTTCAGATGCCTTTGAAAGGATATGATTGAAGACAGCATGTGATACACTTG TATGTTCTGAAATAATGAAGAATATTCTGTAGATGCATGTTTACCCAGCAAATGTGGTTCAGAGGGTTTA ATGGAAAGGGCTATGGGTAAGGCAACTCATGGGGAATGGGCCTGGGGAGTAGTTGAGGGCAGCGATGGGT GTTTCAGCCTGGTAACGCATAGATGAGTTGGGGGGATTGGATGTATAATGCATCTGTGATTGAGGCTGTG TAATATGTTCAATTCTTTTCACTCAATTCTATTCCTTTATAAAAGGCATTCTGATCCTTACTACTCACTG TTGCATGATTGGAAGTACTTAAAACACTGCACAAGTTTAATATAGAGTAATGGAATGTGGCTTTTTTTTT AATACCCAGTTCTATCTGCATGTAATTTGGATTTTTCAAATACATTCATTAGTAACTTAAAACATCAGTT TTCTTTTTGTTTAAGTTACTAATCTATAGAAAGGTGATAGTCTTGGGGTAGATTTCCAGAAAATACTACT TGATAGCTTAGCTTTAACCAGCTACTTTTATATTTTTGTAATATTTATCCACCAAGTTGGAGAAGCAACC TCATAATATCCAGTTGATTTTTTTATGTGTGTGCCTAGCCTCCTTATCACTATGTTTTAAGAATACAACT TTGTAGAGCAATAAAGTGACTATCTTGTTATGTAAACATACTGATTTCTAATGATGTTTTAAAACATTGT CTTGAATGACATCAAGTTCTGGCAGCTAAAGGCATATTTATTTTGAAATGTGTTTTCTCCTACATTTTCC CCCCTAATCTTGGAACATTTTAGATTTATAAGAACTTCAAAAATAGTGCTGAGAGTGCCTATGCACCTCT TACTTGTCTATTTTTATATTAGCGTCTTCTTTTAATTGGTAGGACATTTATGCAAAGTAAAATACTAACT TTGGATCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC016570
ORF Size 744 bp
Insert Size 744
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC016570,
RefSeq Size 2682
RefSeq ORF 744
Locus ID 67878
Cytogenetics 5|5 C3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.