Bcas2 (BC037062) Mouse Untagged Clone

CAT#: MC206283

Bcas2 (untagged) - Mouse breast carcinoma amplified sequence 2 (cDNA clone MGC:46764 IMAGE:4984289), (10ug)


Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bcas2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bcas2
Synonyms MGC7712
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC037062
CCACGCGTCCGGCCAGAAGGCGCTCTTGAAGCCTAGTGCCGCGCGATGGCGGGCACGGGCTTGGTAGCCG GAGAGGTGGTGGTAGATGCGCTACCATATTTTGACCAAGGCTATGAGGCACCCGGCGTGCGGGAAGCGGC GGCGGCCCTGGTGGAGGAGGAGACGCGCAGATACCGACCTACCAAGAACTACCTGAGCTACCTGACGGCC CCGGATTATTCTGCCTTTGAAACAGACATAATGAGAAATGAATTTGAAAGACTCGCTGCTCGACAACCGA TTGAATTACTCAGCATGAAACGATATGAACTTCCAGCCCCTTCCTCAGGTCAAAAAAATGACATTACTGC ATGGCAAGAATGTGTAAACAATTCTATGGCTCAGTTGGAGCACCAGGCGGTCCGGATCGAGAATCTGGAG CTGATGTCACAGCATGGATGCAATGCCTGGAAGGTGTACAATGAAAATCTTGTTCATATGATTGAACATG CACAGAAAGAGCTTCAGAAGTTAAGGAAACATATTCAAGATTTGAACTGGCAGCGAAAGAACATGCAGCT TACAGCTGGATCTAAGCTGAGAGAAATGGAGTCAAACTGGGTGTCGCTGGTGAGTAAGAACTATGAGATT GAGCGGACGATTGTCCAGCTGGAGAACGAGATCTATCAGATCAAGCAGCAGCACGGGGAGGCCAACAAGG AAAACATCCGCCAAGACTTCTAATGACTCAGGCGACGTGGGCTCCGCAGACTCAGCGGGGACTTTCTCGG AGCGACTGTGGTGGTTACATGGTTAGAGACCATGGACTATGTAAACTGTTGTATTGCTTCTGTGTGAGTG TCTTAGCAAAATAAAGTTGTCGACATGTTGCTGTTTTTATGCTATAAAAACCTGGTTTTCAGAATGAGTA TGACTTTAGAATAATTTTGACATATTTTGTAGCAGAATTTTTTTTTTTAAGGCTTCAAATTTTGTAATGA AGCTCCTTTATTTTTAAGGCATCCAACATGTTCTGGAAGCTGGAAACCTTGAATTTGTGTTTTTTGTTGA ATAAAGTTACAGTTCTAAGCATTAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC037062
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC037062, AAH37062
RefSeq Size 1094 bp
RefSeq ORF 678 bp
Locus ID 68183
Cytogenetics 3 F2.2
Gene Summary Required for pre-mRNA splicing as component of the activated spliceosome. Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is required for activating pre-mRNA splicing. May have a scaffolding role in the spliceosome assembly as it contacts all other components of the core complex. The PRP19-CDC5L complex may also play a role in the response to DNA damage (DDR).[UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.