N28178 (BC057092) Mouse Untagged Clone

CAT#: MC206125

N28178 (untagged) - Mouse expressed sequence N28178 (cDNA clone MGC:73464 IMAGE:5703966), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name N28178 (BC057092) Mouse Untagged Clone
Symbol N28178
Synonyms mKIAA1045, A230025O18
Vector pCMV6-Kan/Neo
Sequence Data
>BC057092
GGCGCGCGCCACCGCTGCCGCCGCCTCAGCCTGTCGTGCCGCCCGCGCCGCCCGCTCCCGGTGCTCGGCC CAGCACGTCGGCTCTGGAGCGGCCGTGGGCAGCGCGGGCCCGCGGCGTAGAGTCCGCCGGCCTCGGACCC GCGTCCCGCACGCGGACTGTCCCGGTTACTGCCAGGAGAACGGCGACTAGAAACAGACTCCCAGGACACT GGATGGAGAAACTGGATTCCTAAAGCAACAGGCAGAGGAGAACAGCTGGACCACTTGGGTTGCCTCAAAG ACCTGCCGAGGAGCCATGGGGGTGTTGATGTCCAAGCGGCAGACAGTAGAGCAGGTGCAGAAGGAAGTAC AGGAGGAGAAGGAAGCAGAGGCGAGCGCCCCCGTGGTCCAGGAAGAGAGCAGTATCAACCGCGCAGCCTG GGAGCGGCTCCGAGATGGGCGTGGCGTCGAGCCTGAGGAGTTTGACAGGACCAGCCGATTCACGCCTCCT GCCTTCATCCGGCCCACGCGGAAGCTGGACGATGACAAACCTCCAGATATCTGCTTGGAACCCCGGGAGC CTGTTGTCAACGACGAGATGTGTGACGTCTGTGAAGTCTGGACCGCTGAGAGCCTCTTCCCATGCAGAGT CTGCACCAGGGTTTTCCACGATGGTTGCCTGCGCCGCATGGGCTACCTCCAAGGGGACAGTGCAGTGGAG GTGACTGAGATGGCCCATACAGAGACAGGCTGGAGCTGTTACTACTGTGACAACCTTAACCTGCTGCTTA CTGAGGAGGAGATGTATAGCCTTACTGAGACCTTTCAGCGGTGTAAAGTCATCCCTGATTGCTCCCTGAC ACTGGAGGACTTTGTGCGCTACCGCCACCAAGCAGCAAAGCGAGGGGAGAGCAGCAGGGCCCTGACTGAC GAGCAAGAGGAGCAGGCAGCCCGCCAGTTTGCAGCCTTGGACCCTGAACAACGGGGTCACGTAGAGTGGT CCGACTTCTTGTCCCACGAATCCCTTCTTCTGCTGCTGCAGCTGCGTCCCCAGAACTCTCTCTTGAGGCT CCTTACTGTCAAGGAGAGGGAACGAGCCCGAGCCACCTTCCTGGCACGGGGCAGAGGGAGCACCATCAGC GAGGCGGAGTGCCACCATGCCCGGCATTCTTGGTTCTGTAAACGCCTTACAGAGGCTCCTTCCTGCAGTG TCAGCATCAGCCATGTTGGGCCTATAGCAGACAGCAGCCCAGCTGCCAGCAGCAGCAAGAGTCAGGAGAA GGCCCTGCTGCCCACAGAGCAGGAGTCCAGATACGTGGATTGGCCCACCTTCCTAAGAGAGAACGTCATC TACATCTTGGCTGCTCGTCCTAACAGCGGAGCGATCCACCTGAAGCCCCCAGGATAGGTGGGACAGAGAA GCTCAGTTCTGGGACGGTGGCATCCTCTCTCTCTCTCTCTCTTTCCTTTCTTTTTCCTTTACCAACCTCT GGCACTGAGACTCATGGGAATGGGACACTGCCAACATCTTAATTTGTCATTAAGCTTTATGGCACTGAAG CCACCGTTCCCCTCACAACCGAGGCAGTATTGCCATAGTGAGAGGCCCCAAGAGCTGTGGCATTACCTGC TATGGATCACCTCCTGCCCGCACATCATAAAACTACCTGCCACCTCACGCATACGTGTGTGCACATGCGC ATACAACCACATACATGCCTAGACATCCATGCCTTCAAACTCCTTTGGTTCTTTCTTTGATGAAAAAGGA CCAAAAGCCTTTTGTTGAGCCCCCCTGGTTTAGATAAGAGGGTCTCTTCTCACTCTTTTTATTGGTCAGT TCTGATTCCCAGGAGAAAGAAGGGGACAATTTAAATTCACTTCCCCTCCAGGAGATGCCGAGAGGCCCCC CTGCCCACATGGAAACGCCCTTCGGTGATGACCACTGTTATTTGTGAGTGTCTGTATGTCCCTCAGGTAT GCCATGGTGGGAGAACAGTTCAAAACCATCCCGAAGTTTGTGTTTAAATTCTGATTCCTTGTGATAGAGA AGGAACCTAGTTTGTGGATTTCTGCCTGGAGAAAGTGGAGACAGTCTCTCCCAGAGAGCCAGAAGTCTAG GAACTTTTCAGCCAGGTCATCCAACTTCACAAGTCCTTAGCAGAACAGGAAAACCAAGATGAGACCCCTG GTCCCTAGTCTTCAAGTGGTCCAAAGCTCTAGGGACCCAAGAAGAACAGATACACTGGCAGGAATCACTG TGTGTGAGGTGCTTTAGCCTAGGTGGCGGCCTCAGAGGCCGATGAGGATGCAGAAAAGAAAGCCCGGGCT TTTCCTACTTTCCAGCCCAACTCAGCCACAGACATAGAACTGTGGCATCATATGGAGGGCAAGCCACCCT CTTACATAGCCAGAGGAGCTCTGCAGAATGCCTACGCAGTTGTGCTTTTTAAGAAGAGACAACAAAGGCT CGAGAAGATTTGTATCTCAACTGTCAAGAAGTCCTAGTCAGCGTCAGAAGGGGGACAGTGTGTCCTTCTC CCGTCTCCCCAGTCGCTGCTTCTCCCTGATGCTCACTCCGTGTCTTCCCCTCACCTGAGAGGACCTTGTG GACAAGTGGAGAACGAACGCCATGGGTGTAGCAAGCTTGGCCTCCAGGCTTTGTGTAACCCATCACCCAG TTCTGAAGCTCTGGAGTCAGAACATGGTGTGGGTCAGCCCTAAGACCTAGGGATCCAGGTTCTGGATTTC TGTTTTCAACCAGATGACTTGGGTATGGGCAGTTCTGACAACTAGTTCTTCATGAGAGAACTGAGCAAAG TCCCGCAGAAAGCTTGCATTGTCTCCACTGCTGAAAGCACTTGTACTAAAGTGGATGGTTTCAGGAGAAG GAGCATGCTGCTCAGTGTTGAGAGGCTCAGATGCCATGGGCACCTCCAGCCAAGCCTTGCTAAGAACCCT GCATGCTCTCCTTCTGTAGGACCTGCCTTACCTAGAAGCAGGGTAGTATACTGCTGGAGACAGATTATTT AGGACTGAAATGAAGCAGGCAGGAGATACATGTGGGTTCATTTTGAAACCCACAGCTTTTAAAAACTATT ACTTAAAGCTGGGCATGGTGGTACATACCCTTAATCCCAGCCCTTGAGGGACAGAGGCAGGTGGATCTCT ATGAGTTGAAGGCCAGACTGGTCTAAATAGCAAGTTCTAGGCCAGCCAGGATTACACAAGTGAGACTTGG TCTCAATAACAACAATGAAAATGACTCGGCCATGTTCCCAGGACTGATCAGTAAGATGGCCCATTATTGA ATCGAGTCGAAAACAAAGCACAAACCTGCTGGGCTCAAGGACTGCATCTGTAGCAGCCAGCCCTGGGGTT TTCCATTGAGAAGATTAAAGCATGCTAAATTCAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN BC057092
ORF Size 1092 bp
Insert Size 1092
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC057092,
RefSeq Size 3410
RefSeq ORF 1092
Locus ID 230085
Cytogenetics 4|4 A5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.