Glrx5 (BC058371) Mouse Untagged Clone

CAT#: MC206073

Glrx5 (untagged) - Mouse glutaredoxin 5 homolog (S. cerevisiae) (cDNA clone MGC:66779 IMAGE:6819353), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glrx5 (BC058371) Mouse Untagged Clone
Symbol Glrx5
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC058371
TGGCCGCAGAGGCGGTGGACAGCGAGCGGGCATGAGCGCGTCCCTGAGCCGGGCGGCGGCGGCTCTGCTG CGCTGGGGGCGAAGCGCTGGTGGCGGTGGCCTGCCCGGAGCCGGCGTGCGGGCGGCGAGCTCGGGCGGCC AGGCGGAGCAGCTGGACGCGCTGGTGAAGAAGGACAAGGTGGTGGTGTTCCTCAAGGGGACGCCCGAGCA GCCCCAGTGCGGCTTCAGCAACGCCGTGGTGCAGATTCTGCGGCTGCACGGTGTTCGCGACTATGCGGCC TACAACGTGCTGGACGACCCGGAGCTGAGGCAAGGTATTAAAGACTACTCCAACTGGCCAACCATCCCGC AAGTGTACCTCAACGGCGAGTTTGTGGGGGGCTGTGACATCCTTCTGCAGATGCATCAGAATGGGGACCT AGTGGAAGAACTGAAAAAGCTGGGTATCCGCTCTGCCCTGGTAGATGAGAAGGACCAAGACTCCAAGTGA GGGCCCCGGGCCCTCGCCGAGCAGAGCGCCCTCTCCATCCTCGGGGCCAGAAAAGCCTTACTGCGTGGTG GTGCCCTGTTGCTGTGATGCTTGCGCTGGGCCTCCTGGCAGCAAGCGGGCAGGTGCTTTTACTTTAGTCT CTGGCTCAGAATTCCCTCTGGTGAACGTACAACCACTGCACTGTAAATCAATGTCGCGATCCTGTATTGC TATAACCGTGATCTGTTCTTACGTTGTCTTTATTCTCTGCCGGCCGGCTTTGGGAGTCACTTCTGATTCT TGTTTGGGTTGTAGAGATGGTAAAGCCCCCTGATGTTTTTGTAACTTCCTGTAAAAGGGAAATGATGGAC AGAGGAGAAAATGTGGTGGCTAGAGTTGTTTTGTAAAATTAAATTGCCAACACAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN BC058371
ORF Size 459 bp
Insert Size 459
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC058371,
RefSeq Size 931
RefSeq ORF 459
Locus ID 73046
Cytogenetics 12|12 E
Gene Summary This gene encodes a mitochondrial protein, which is evolutionarily conserved. It is involved in the biogenesis of iron-sulfur clusters, which are required for normal iron homeostasis. Mutations in the human gene are associated with autosomal recessive pyridoxine-refractory sideroblastic anemia. [provided by RefSeq, Sep 2015].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.