Glrx5 (BC058371) Mouse Untagged Clone
CAT#: MC206073
Glrx5 (untagged) - Mouse glutaredoxin 5 homolog (S. cerevisiae) (cDNA clone MGC:66779 IMAGE:6819353), (10ug)
Product Images
Frequently bought together (2)
Other products for "Glrx5"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Glrx5 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC058371
TGGCCGCAGAGGCGGTGGACAGCGAGCGGGCATGAGCGCGTCCCTGAGCCGGGCGGCGGCGGCTCTGCTG CGCTGGGGGCGAAGCGCTGGTGGCGGTGGCCTGCCCGGAGCCGGCGTGCGGGCGGCGAGCTCGGGCGGCC AGGCGGAGCAGCTGGACGCGCTGGTGAAGAAGGACAAGGTGGTGGTGTTCCTCAAGGGGACGCCCGAGCA GCCCCAGTGCGGCTTCAGCAACGCCGTGGTGCAGATTCTGCGGCTGCACGGTGTTCGCGACTATGCGGCC TACAACGTGCTGGACGACCCGGAGCTGAGGCAAGGTATTAAAGACTACTCCAACTGGCCAACCATCCCGC AAGTGTACCTCAACGGCGAGTTTGTGGGGGGCTGTGACATCCTTCTGCAGATGCATCAGAATGGGGACCT AGTGGAAGAACTGAAAAAGCTGGGTATCCGCTCTGCCCTGGTAGATGAGAAGGACCAAGACTCCAAGTGA GGGCCCCGGGCCCTCGCCGAGCAGAGCGCCCTCTCCATCCTCGGGGCCAGAAAAGCCTTACTGCGTGGTG GTGCCCTGTTGCTGTGATGCTTGCGCTGGGCCTCCTGGCAGCAAGCGGGCAGGTGCTTTTACTTTAGTCT CTGGCTCAGAATTCCCTCTGGTGAACGTACAACCACTGCACTGTAAATCAATGTCGCGATCCTGTATTGC TATAACCGTGATCTGTTCTTACGTTGTCTTTATTCTCTGCCGGCCGGCTTTGGGAGTCACTTCTGATTCT TGTTTGGGTTGTAGAGATGGTAAAGCCCCCTGATGTTTTTGTAACTTCCTGTAAAAGGGAAATGATGGAC AGAGGAGAAAATGTGGTGGCTAGAGTTGTTTTGTAAAATTAAATTGCCAACACAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | BC058371 |
Insert Size | 459 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC058371, AAH58371 |
RefSeq Size | 931 bp |
RefSeq ORF | 459 bp |
Locus ID | 73046 |
Cytogenetics | 12 E |
Gene Summary | This gene encodes a mitochondrial protein, which is evolutionarily conserved. It is involved in the biogenesis of iron-sulfur clusters, which are required for normal iron homeostasis. Mutations in the human gene are associated with autosomal recessive pyridoxine-refractory sideroblastic anemia. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.