Akt1 (BC066018) Mouse Untagged Clone

CAT#: MC206055

Akt1 (untagged) - Mouse thymoma viral proto-oncogene 1 (cDNA clone MGC:90109 IMAGE:5716837), (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Akt1 (BC066018) Mouse Untagged Clone
Symbol Akt1
Synonyms Akt, PKB/Akt, PKBalpha, PKB
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC066018
GCGGGGCGGGGAGAAGGCGGGCCGGCGGCGGCGGCGGCAGCACCGAGTCGGCGGGCGGCCGGCCCAGCGC GGCAGCGCACGCGAGTCCGGGACCAGCGGAGCGGACCGAGCAGCGTCCTGTGGCCGGCACCGCGGCGGCC CAGATCCGGCCAGCAGCGCGCGCCCGGACGCCGCTGCCTTCAGCCGGCCCCGCCCAGCGCCCGCCCGCGG GATGCGGAGCGGCGGGCGCCCGAGGCCGCGGCCCGGCTAGGCCCAGTCGCCCGCACGCGGCGGCCCGACG CTGCGGCCAGGCCGGCTGGGCTCAGCCTACCGAGAAGAGACTCTGAGCATCATCCCTGGGTTACCCCTGT CTCTGGGGGCCACGGATACCATGAACGACGTAGCCATTGTGAAGGAGGGCTGGCTGCACAAACGAGGGGA ATATATTAAAACCTGGCGGCCACGCTACTTCCTCCTCAAGAACGATGGCACCTTTATTGGCTACAAGGAA CGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGA AGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCAC CTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCAGATGGACTC AAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGA TGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAGCTACTGGG CAAGGGCACCTTTGGGAAGGTGATTCTGGTGAAAGAGAAGGCCACAGGCCGCTACTATGCCATGAAGATC CTCAAGAAGGAGGTCATCGTCGCCAAGGATGAGGTTGCCCACACGCTTACTGAGAACCGTGTCCTGCAGA ACTCTAGGCATCCCTTCCTTACGGCCCTCAAGTACTCATTCCAGACCCACGACCGCCTCTGCTTTGTCAT GGAGTATGCCAACGGGGGCGAGCTCTTCTTCCACCTGTCTCGAGAGCGTGTGTTCTCCGAGGACCGGGCC CGCTTCTATGGTGCGGAGATTGTGTCTGCCCTGGACTACTTGCACTCCGAGAAGAACGTGGTGTACCGGG ACCTGAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATCAAGATAACGGACTTCGGGCTGTGCAA GGAGGGGATCAAGGACGGTGCCACTATGAAGACATTCTGCGGAACGCCGGAGTACCTGGCCCCTGAGGTG CTGGAGGACAACGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGT GTGGCCGCCTGCCCTTCTACAACCAGGACCACGAGAAGCTGTTCGAGCTGATCCTCATGGAGGAGATCCG CTTCCCGCGCACACTCGGCCCTGAGGCCAAGTCCCTGCTCTCCGGGCTGCTCAAGAAGGACCCTACACAG AGGCTCGGTGGGGGCTCCGAGGATGCCAAGGAGATCATGCAGCACCGGTTCTTTGCCAACATCGTGTGGC AGGATGTGTATGAGAAGAAGCTGAGCCCACCTTTCAAGCCCCAGGTCACCTCTGAGACTGACACCAGGTA TTTCGATGAGGAGTTCACAGCTCAGATGATCACCATCACGCCGCCTGATCAAGATGACAGCATGGAGTGT GTGGACAGTGAGCGGAGGCCGCACTTCCCCCAGTTCTCCTACTCAGCCAGTGGCACAGCCTGAGGCCTGG GGCAGCGGCTGGCAGCTCCACGCTCCTCTGCATTGCCGAGTCCAGAAGCCCCGCATGGATCATCTGAACC TGATGTTTTGTTTCTCGGATGCGCTGGGGAGGAACCTTGCCAGCCTCCAGGACCAGGGGAGGATGTTTCT ACTGTGGGCAGCAGCCTACCTCCCAGCCAGGTCAGGAGGAAAACTATCCTGGGGTTTTTCTTAATTTATT TCATCCAGTTTGAGACCACACATGTGGCCTCAGTGCCCAGAACAATTAGATTCATGTAGAAAACTATTAA GGACTGACGCGACCATGTGCAATGTGGGCTCATGGGTCTGGGTGGGTCCCGTCACTGCCCCCATTGGCCT GTCCACCCTGGCCGCCACCTGTCTCTAGGGTCCAGGGCCAAAGTCCAGCAAGAAGGCACCAGAAGCACCC CCCTGTGGTATGCTAACTGGCCCTCTCCCTCTGGGCGGGGAGAGGTCACAGCTGCTTCAGCCCTAGGGCT GGATGGGATGGCCAGGGCTCAAGTGAGGTTGACAGAGGAACAAGAATCCAGTTTGTTGCTGTGTCCCATG CTGTTCAGAGACATTTAGGGGATTTTAATCTTGGTGACAGGAGAGCCCCTGCCCTCCCGCACCCGCTCCC GCGTGGTGGCTCTTAGCGGGTACCCTGGGAGCGCCTGCCTCACGTGAGCCCTTCTCCTAGCACTTGTCCT TTTAGATGCTTTCCCTCTCCCGCTGTCCGTCACCCTGGCCTGTCCCCTCCCGGCCAGACGCTGGCCATTG CTGCACCATGTCGTTTTTTACAACATTCAGCTTCAGCATTTTTACTATTATAATAAGAAACTGTCCCTCC AAATTCAATAAAAATTGCTTTTCAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN BC066018
ORF Size 1443 bp
Insert Size 1443
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC066018,
RefSeq Size 2701
RefSeq ORF 1443
Locus ID 11651
Cytogenetics 12 F1|12 61.2 cM
Gene Summary This gene encodes the founding member of the Akt serine-threonine protein kinase gene family that also includes Akt2 and Akt3. This kinase is a major downstream effector of the phosphatidylinositol 3-kinase (PI3K) pathway that mediates the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). It is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-phosphoinositide dependent kinase-1. It then further phosphorylates different downstream proteins in response to various extracellular signals and thus plays a pivotal role in mediating a variety of cellular processes, such as glucose metabolism, glycogen biosynthesis, protein synthesis and turn over, inflammatory response, cell survival (anti-apoptosis) and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.