Kcnab1 (NM_010597) Mouse Untagged Clone

CAT#: MC206015

Reviews ()
Write a review

Kcnab1 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, beta member 1 (Kcnab1), (10ug)

  View "NM_010597" in other vectors (6)

USD 210.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kcnab1 (NM_010597) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Kcnab1
Synonyms Akr8a8; Kvbeta1.1; mKv(beta)1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC014701
CCTCTGAAGGCATCCAGGAAGGGGGGCAAGAGGGGTTAAAAGACAGCCGAAATCCCCCCAACTGCTCACC CTCTGCCGACCGCCTGTGTTGTGGGGTTCTGAGAGGACCTTGCTCTGTCCTGGGAAGCAATGCAAGTCTC CATAGCCTGCACAGAGCACAATTTGAAGAGTCGAAATGGTGAGGACCGACTTCTGAGCAAGCAGAGCTCC AACGCCCCCAATGTGGTGAACGCAGCCCGGGCCAAATTCCGCACTGTCGCTATCATCGCTCGCAGCCTGG GGACCTTCACCCCTCAGCATCACATTTCTCTCAAAGAGTCCACCGCAAAGCAGACTGGCATGAAATATAG GAATCTTGGGAAATCAGGACTCAGAGTTTCATGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAA ATCTCAGATGAGGTTGCTGAACGGCTGATGACAATTGCCTACGAAAGTGGAGTTAATCTCTTCGACACAG CTGAGGTCTATGCTGCTGGGAAGGCTGAGGTGATTCTGGGAAGCATCATCAAGAAGAAAGGCTGGAGGAG GTCCAGCTTGGTCATCACAACCAAACTCTACTGGGGTGGAAAAGCTGAGACAGAAAGGGGACTGTCAAGA AAGCACATCATTGAAGGACTGAAAGGCTCCCTCCAGAGGCTGCAACTGGAATACGTGGATGTGGTCTTTG CAAATCGCCCAGACAGCAACACTCCCATGGAAGAAATCGTTCGAGCCATGACGCACGTGATCAACCAAGG CATGGCCATGTACTGGGGCACCTCGAGGTGGAGCGCGATGGAGATCATGGAAGCCTACTCTGTCGCACGG CAGTTCAACATGATCCCGCCTGTCTGTGAGCAAGCTGAGTACCATCTTTTCCAGAGAGAGAAGGTGGAGG TCCAGCTGCCGGAGCTCTACCATAAAATAGGAGTTGGTGCAATGACATGGTCTCCACTTGCTTGTGGAAT TATTTCAGGAAAATATGGAAATGGGGTGCCAGAAAGTTCTAGAGCTTCACTGAAGTGCTACCAGTGGTTG AAGGAAAGAATCGTAAGTGAAGAAGGGAGAAAACAGCAAAACAAGCTGAAAGACCTCTCTCCAATCGCTG AGCGCCTGGGGTGCACGCTACCTCAGCTGGCTGTGGCGTGGTGCCTGAGAAATGAGGGTGTGAGTTCTGT GCTCCTGGGATCATCCACTCCGGAACAACTCATTGAAAACCTTGGTGCCATTCAGGTCCTCCCTAAGATG ACATCTCACGTGGTGAACGAGATTGATAACATACTGCGCAACAAGCCCTACAGCAAAAAGGACTATAGAT CATAAGGCAATGCATGAGCCACTTAAGCTGCATGGGTAAAGTCATGATGGGTAGGCAGTGCAGAACGGCC TTACCAGCCACTCTTTTCAATCACTTAGCAGTTTGCTGCTCAACCTCTAGTGTCCCAGGATTCTCTGAGG TTTCTGCTGTTGCTACCACTGTGCACCCTGAATTCTGAACACATCTGAAAATTCACAAGCCAGAAAATCC ATTCTATTTTCTTATCTTGGACTGGTCCCCTACCCTGGCACTGGTCTGTGTACCTCATGTTTTTGCAATG GAAAGAATGCTGGGGTAGGGGAATCTATTATCTTCAGAAGAAGGCTGTACATATATATTTTTTTCAAAAG AACAAATTTCACAAGATACAGTATATGACCTGCATAGGAAACAGGATATCCTCACTCTTTAGTCTTGCTC GGGAGAACAAACTGAACTAGATTTTTCCCCCCATATTTCATATTCACACTAGCAAGTTTTATGTCACCTG ATATTCAAATAAAATTTCTAGATATTTGCTTTCACTATCTCTAAAGTTATATTGTTGCCTGGCCCTGTAC AATTTAACTGGGGTGTCTCTCAGGGTTCTAACATATCCATTTGCATAGTTATAAAGGCATGACTATCCCA AGATACATAATAGATACATAATGCTGATTTATAAAAAGGTCACAATGTTATGGAAACAGCTTTAAATAAA ATGTTAAGTGTTCATTTTTTACTTTCTATTAAAGCCTACATTTACTTTCAATTGCTTGTAGGCACAACTT CTGTTGAGGCTAAATATTTGACTTTAAAAATACATACATGTTCAGTTTTGTAATTAAACCTATAAATACC CAGAAAGGCAAGTGTTCAATTTACCATTGGGACATTATCATATAATGCTTGGAATTTTCTGAAGTTATTA ACATGAAAACAAATCATAGGCGATGTTAAGAAAAAGACAAAAAAACATTTTTTTTCTCATTCCTCGGCAC ATGCTAGATGACTTAACTTGCCCAAAGAAAAAGCAAAATATTCAAGAAGCTCCTGGTTCGAATTGTATCA CACCCTACACCATATGCATGAAAGCTCTTTGCATGGAATAAAGGGGCCTAGCTTTGCACTCAGAATCTGA GATACACTTAGCTCTGCCTCTACGGGCTAATTCCCCTCACTGTATCCCACTTGAGAAAAACTGTAAAACT ATATATACTGTGTGGCTATCTGTAAATACGGATAAGACACAAGGGGTTTTTGTTGTTGTTTTGTTTTCTG TAAAGGTGGGGTCATTTTCTAACTCTTATTTGTCTAACTATAGATGGGCAACATTCTACTTCATCTAGTT AGCAAGTTCTCCATCACTTTAAGATTTACACAAGAAATATACGAACTTAAAATCATTTTCGGATATGTAC CACATGGTTAAGTTCTAAATCTTAAACTATCAGTGAAAGATACCAAGAAATATGATTGTGACTACCTAGC TAGCCTCCAGCAGGCAACTTGGGAGTTTCACCCGTGAATATCTGAATAATGATAGAGATGAGCTAACTTT CCATCTATTCACTGTAAATGTAATCCACTGAACTACTGTACGTATAAATGAGTGGAGTGCTGTCTAAATA AAAATCAATTTATTTGCTTAGAGTAATAAAGGCATCTGCAATCTCAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_010597
ORF Size 1206 bp
Insert Size 1206
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC014701, AAH14701
RefSeq Size 3023
RefSeq ORF 1206
Locus ID 16497
Cytogenetics 3 30.15 cM

Other Versions

Other products for "Kcnab1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones