Hykk (NM_177351) Mouse Untagged Clone

CAT#: MC205984

Hykk (untagged) - Mouse aminoglycoside phosphotransferase domain containing 1 (Agphd1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hykk (NM_177351) Mouse Untagged Clone
Symbol Hykk
Synonyms Agphd1; C630028N24Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC038618
CCACGCGTCCGGGACGTCCGGTCGCTGTGCGTGAGAGGAGGTGGAAGAGACTGAAGCGAGTCAAGGGTCT CTCTGAGGGGACATCCCCGAGAAGCGGCGGCGGGCTCCTGCAACCCTTGCGCTCCTCAAACTCACTGCGT GCTGACGCGGCAGGTCACTGCCCAGCCCCAGCCCTGCTGAGATTTCAGTGCGCAGTTTTGAGGGTCCCAC CCTCCGCGGGCCTGCATGGTTTGGGGGTGGAAGCCATCCTAAGGCTCCTCTGGACCTGAGACAGGCCAGG AACGGGTTGTGGGCCACCTCCCTCCCATCGGCGTCTTTCGCTCCTCAGCAAGACCCCCTGGAAGTGAGTC TTGCTTCCAATCGCCCTTGGAGTGTAGAGTTCCTGCAGCCCGTGAGCTGTGAGTGGAGGCAACTCACGAA ATAAGTGCAGGGAACATCACTGCCTGCTTCCCAAGCCTGGAAGCTCACAGCAGAGGGGTCGTCGAAGACA GACGTGGAGAAAGTGCTAAGGCAGAAGTCACAAAGACTTTGTAACACTTTAGGAGAAGACATAATGTCAA GTGGAGCTGGCTGGCAGTCACAGGCTTCTGCCAAGCCCGTTTTTACTGAGGCACAAGCCTCTGCACTGGT AGAATCGGTATTTGGGTTCAAAGTTTCCAAGATCCAGCCACTCCCTAGCTATGAGGACCAAAACTTTCGT GTTCACATTGCAAGAGGCAAAGAGACTACAGATGACCCAGTTGAATATGTCCTCAAAATAAGCAATACGG AGTCTAGCCAAACTCCAGAGCTGATTGAAATGCAGAACCATGTCATCATGTTCCTGAGAGCAGCTGGATT CCCAACAGCCTCCGTATGCCGAACTAAAGGGGACAACACCATCTCTCTCATATCCATTGACAGTGGATCT GGAGTCAAAAGCTACTTGGTAAGAATGCTCACTTACCTCCCAGGAAGACCAATAGCTGAGGTTGCCATCA GCCACCAGCAATTATATGAAATAGGAAGGCTGGCTGCCCAATTGGATAAAGCCCTAGAGGAATTCCATCA TCCAAAGTTAAGTCTTTTTCATCGGGAGAACTTCATCTGGAATCTGAAAAATGTTCCTCTTCTAGAGAAA TACATGGGTGCCCTGAGCCAAAGTCGAAACCGGGAGATTGTTGAACAGGTCATTCGGATGTTCAAGGAAG AAGTAATGACCAAATTAAGTCATTTTCGAGAATGTATTAATCATGGTGATCTTAATGACCATAACATTTT AGTAGACTTCAGCAAGTCAGCCTCTGGAGAAGGTGTGCATCAAGTGTCTGGGATTTTAGACTTCGGTGAC ATGAGCTATGGCTACTATGTGTTTGAAGTGGCAATCGTTATCATGTACATGATGATTGAAAGCACAAACC CTATACAAGTAGGAGGTCACATCCTCGCAGGGTTTGAAAGTGTGATCCCCCTGACGGCTGTAGAGAGGCA GGCTTTGTTTTTACTTGTATGCAGTCGTTTTAGCCAGTCTCTCGTCATGGCTGCATACTCCTGCCAGCTG TACCCAGAGAACAAAGAGTACCTCATGATTACAGCCAAAACCGGATGGAAGCATTTACAGCAGCTGTTCG ACATGGGCCAGAAAGCCGTTGAAGAAATCTGGTTTGAAACTGCCAAGTCCTATGAATCTGAGATATCCAT GTGACTGCCGCGGTAAAAAAATTAAATCGCTCAAAACTCCCCGGTGGTGCACATGCGCTCGGCGCTATGC ACCCACAATGTTCTGGATTCCCGAGTGAAAGACACACACGCACAACCTTATTTTTAATATGCCCTAAGCA GGTCAATTGCCGGGCCACTCCCTAACTCCACTTGGTTAACGCACACTCCACTTCAATATTCCTGAGTTAT TACTTACTAAAATCTATATATTATCTTTGTGCCCTGGACCTGGCTGGGCAGCCCTCCTGGGCAGCTTTCC CCCTGCACCTACATGTCGGCGGTCTTTCCCTTCTGTATCTTTCTGGCGTGGTCCTATGCCCCTCTTGTGG CAAAATCTTCTCTTCCTACTCTCTCTGTCTCTTCCCAGGAATCCTAAAAGTCCCACCTCTGTCTCTGCCC AGTCATTGGCCGCTGGTAATTTTATTGACAAGTCAAAAACTAACTGGGGACAGGCTTCCTTTAGTCCTAA ATGTGGGACACTGCAAACAGGTATTTTTGGTAACATAATTAGCATGAGAACACAAGCCGTTACAAGTGAC CTTAGAAAAGCTTGTGTTAATTAAAACCCAGTTGGCCTAGAACAAATTTATGAAGGATTTTTGTGCAGAG TTAAAACTGAAATGGTAAAACAGATCCATTCTCACAGGGCAGTGGTGGCGCACGCCTTTGATCCCAGCGC TTGAGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAG CCAGGGCTATACAAAGAAACCGTGTCTCGAAAAACAAAACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_177351
ORF Size 1131 bp
Insert Size 1131
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC038618, NP_796325
RefSeq Size 2505
RefSeq ORF 1131
Locus ID 235386
Cytogenetics 9|9 B
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.