Neurod4 (NM_007501) Mouse Untagged Clone

CAT#: MC205890

Neurod4 (untagged) - Mouse neurogenic differentiation 4 (Neurod4), (10ug)

  View "NM_007501" in other vectors (6)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Neurod4 (NM_007501) Mouse Untagged Clone
Symbol Neurod4
Synonyms AI846749; ATH-3; Atoh3; bHLHa4; MATH-3; Math3
Vector pCMV6-Kan/Neo
Sequence Data
>BC054391
CAGAAGCTCCAGTCAGATCACAGGAGCTGCCCAGAGACTGTGGTACTGAAAGAACTACTCGCGGGAGCTG ACCCCGGGAAAGAGAATCTATACATGGCAAAAATGTATATGAAATCCAAGGACATGGTGGAGCTGGTCAA CACACAATCCTGGATGGACAAAGGTCTGAGCTCTCAAAATGAGATGAAGGAGCAAGAGAGAAGACCGGGC TCTTATGGAATGCTCGGAACCTTAACTGAAGAGCATGACAGTATTGAGGAGGATGAAGAAGAGGAAGAAG ATGGAGATAAACCTAAAAGAAGAGGTCCCAAGAAAAAGAAGATGACTAAAGCTCGCCTTGAAAGATTCAG GGCTCGAAGAGTCAAGGCCAATGCTAGAGAACGGACCCGGATGCATGGCCTGAATGATGCCTTGGATAAT CTTAGGAGAGTCATGCCATGTTACTCTAAAACTCAAAAGCTTTCCAAGATAGAGACTCTTCGACTGGCAA GGAACTACATCTGGGCCTTGTCTGAAGTCCTGGAGACTGGTCAGACACTTGAAGGGAAGGGATTTGTAGA GATGCTATGTAAAGGTCTCTCTCAACCCACAAGCAACCTGGTTGCTGGATGCCTCCAACTGGGGCCTCAA TCTACCCTCCTGGAGAAGCATGAGGAAAAATCTTCAATTTGTGACTCTACTATCTCTGTCCACAGCTTCA ACTATCAGTCTCCAGGGCTCCCCAGCCCTCCTTATGGCCATATGGAAACACATTCTCTCCATCTCAAGCC TCAACCATTTAAGAGTTTGGGTGACTCTTTTGGGAGCCATCCACCTGACTGCAGTACCCCCCCTTATGAG GGTCCACTCACACCACCCCTGAGCATTAGTGGCAACTTCTCCTTAAAGCAAGACGGCTCCCCTGATTTGG AAAAATCCTACAATTTCATGCCACATTATACCTCTGCAAGTCTAAGTTCAGGGCATGTGCATTCAACTCC CTTTCAGACTGGCACTCCCCGCTATGATGTTCCTGTAGACCTGAGCTATGATTCCTACTCCCACCATAGC ATTGGAACTCAGCTCAATACGATCTTCTCTGATTAGAGCAATAAGATAAGCACCAATATTTCAGAGAATG AAGTGGAGATTTTTTTCACATTTCTAGTGGCTGAGCTAAACTCTCAGAAAATTTAAAAGAACCTTTGGAT ATGCATCAAACATAATAGTCCTAGTTTGTTCAGAACTTCCTGTACCTGCTAACTTTCTTCCCATTAACTT CTCACATTGGACCAGTCCTACATTTGGTAAACTTAAGTGAATATATTTGATGGTTTGAGGCCACATGGTA ATAGAACAGAAAGAAAGCCCAGGCCCTGTTCCAATGGTGCCAAAGATTAATTGAATGCTCTGCCAATTAA CTTTCCATTTCCAGTGTTTTTATTGCTTTCTGATAAACATGAAGCAACTGTTCCAAATCAACATATACCT TTCACCTCCCACACATTTTTAAATTTAAAAGCAATCAAAGCAAATAGCAAAAATGGAATGATTATACAGA ACTGGAAGGAGCATCAAGTACATGTCTGTTGGCTTATAGAATACAAAATTTGTGTGAATTTGACAAATCA TCTTTGTGTCTATTTAAATATAACTTCCAGAGCCTAAAATAATAACTTGGATGTTACCATAAATAACCAG TATGTTCTTTAAGAGATCAGCTCTACTTATTACTGTGCTGAAAGGTATACACACCTTTTTTAGTGATTGG AGAACCATGATAGAAGCCTCACACAAACTTTATTCTTTATACTATTTAAAAAACAACTGTCTTAGTACTA GGAGACAAGCAAGAAAGACATTGAAATTTCTCTTCTGGCACACAGAAATATCACCTAGCTCATTTCTTAG CTTCCGTGACTATAGGGCTGTAGAATTTTGCAGGTATTCAGGTGCTTCAGTTAGAATCAGAACTCAGCCA GGTTCATACTGTAGAGCAATAAAATGGTGGTTGGCTGCTATCCCAACTAACACAGTTAAAGAACTCTGCC TCACACATAGCCACTGGAAAAATGTGGATATTCTCCAGCAAGATGAATTTCACTGTTTAAAGCAATGCAA TTAAAGCCATAGAGTTTCGTCCACTCCAGTATCATATATTCCAGAACTGTTGTAATCAATCTTGAATTCT TACAACATAAATGCAACTCCTTACTTCCCACCTAACACTGATTGTTATATTGTCTTCAATTCCAAGATAT TATGCAATTATATGCAAAATTTTGATTAGAATCAAAATTAAGAGTCAATGAATCTGTCTGTATCTTCAGG ACGGGTTTTGATCAGTTTTAAGAAAGTTTATTTTCCTTTATGTGGCATCTCTTTTCTTTGTAACCACACT GGTTCAGCCAAGTTTCTCTTCTCCAGAGAAATTAGCTCTGAGAAATTTTACTATCATGATCCATCTTCCA CAGCAATTATTTAGGTTCAACTCAAGAGTATACATAGTTTATTTATAGTGGGTGAGGATACACCTCCAAG AATAAATTTTAACAACATTAATGACATATGAATATGCCATTTTATCTACCAAACTATATATGTATCTCTT TTCTTTATTGCCCTTATTTATTTCTTCACACTGAGAGTTATTTTGTGTCCATCTTATTGCAGCACTTACT CTGCTCTACTTTGCACCTTTGGATTATAAATATGTTTAAAAGTCTGTAAAGACGTCTTAAACAACTCGTG ACAGTAATTCACCACCCCTAAGACCTTGAATCACCCTAGTGGAAATAGGCAAGGAGAATTATTTATAGAA TCATCCTATGTAATTTTTTTTGAGAATTTGCTCTACCTAGCATTTATGTTTATAGATAATTGCTATCTGC ATTATTTATTAGGTTCTATTTATTTAATTTATCTTTCTTTCTTTTTATGTAAACATTTGTGCCCCATAGA TATAGCCTCAAAGCTTCACTGGGAAACTAGCTTATATGTTTGGAGTGAGAGAAAAGGAGAAAATCAGTTC TTGATTGCTTGCAATGGTTTTATAAAACAGAGCAATAATTTGAATAGATATGCAACTTAATGGTTTTAGA TTTTTTTCCTTTAAGGTGCAACAGAGTTACATTATTATTTATGACTTTGGAGAATGTAGTACATGTGAAC CAGGACTGTAGGCTTGTGAAGAGAGATTTTATAATTAAATACAAATTTAGTACTGTACTATGCTTGGAAA GAACTTGTTCTTTAAATAATGTTTAGTCTTCTGGGAGTGTTTTCAGATAAAATGAAGCAATTGTTTAAAA GAAATGGCTGTTTTCCCTCCCTTTTCCAGTAGCAATAAAGCTTTGAGTGTTATTAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_007501
ORF Size 993 bp
Insert Size 993
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC054391, NP_031527
RefSeq Size 3376
RefSeq ORF 993
Locus ID 11923
Cytogenetics 10 D3|10 77.81 cM
Gene Summary This gene belongs to the neurogenic differentiation factor family and encodes a basic helix-loop-helix (bHLH) transcription factor which is expressed in the developing nervous system with high levels of expression in the brain, retina and cranial ganglions. Expression gradually becomes restricted to the neural retina. It is a key gene in the Ngn2-regulated neuronal differentiation pathway, coordinating the onset of cortical gene transcription. This gene also regulates amacrine cell fate determination in the retina. [provided by RefSeq, Jul 2016].
Transcript Variant:

Other Versions

Other products for "Neurod4"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies