Ap4s1 (NM_021710) Mouse Untagged Clone
CAT#: MC205886
Ap4s1 (untagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1), (10ug)
"NM_021710" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ap4s1 |
Synonyms | AI314282 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC053339
GGACGCCATGCTAAAAGCCAAAATGGCTGCCCCAAGGATGCCCGCAGCGCGCCGCCCGTGAGGAGGGAGC CGGGCGCGCCGTCACCGCTCGCCGGCCGGAGCGGCTCAGGTTCCAGCTACGGTCATCCAGTGCCATAACT TTTAAAGGATATTGCAAAGAAACTGGGAAAGGGTGAAAAAATGATCAAGTTTTTCCTTATGGTGAACAAG CAAGGGCAGACCCGACTGTCTAAGTACTACGAGCATGTGGACATTAATAAACGTGCGCTTCTGGAGACTG AGGTCAGCAAGAGTTGCCTGTCTCGGTCCAGCGAACAATGCTCATTCATTGAATACAAGGATTTTAAACT GATCTACCGGCAATATGCAGCTCTCTTTGTTGTGGTTGGAGTTAATGACACTGAGAATGAGATGGCTATC TATGAATTTATACACAATTTTGTGGAAGTTTTAGATGGGTACTTCAGCCGAGTGAGTGAATTAGATATAA TGTTTAATTTGGATAAAGTTCACATCATTTTGGATGAGATGGTGTTAAATGGCTGCATTGTGGAAACTAA CAGAGCCAGAATTCTTGCCCCTCTGCTGATTCTTGACAAGCTGTCGGAAAGCTGATGAAGACGATCAGGG TTTGAGTGCTGTGAAGGCCAAGGAAGAGATCATGGATGACAGCAGCCTTCTATAGTTCCTATCCCATAGT TCCTAAAGAGAAAACAATTCTTGTGTACACATTTTTCTCTTAACAGAGAGCCACAATTTTACTTGGTAAC TGTAAGCTTGCTTTTCCTTCTATAGGTACTGCAGGGTTGCAGTGTGATGCAAGCATGGCAGTTGTCCATC AGCCAATAAACTTCAAATTGACTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021710 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC053339, AAH53339 |
RefSeq Size | 895 bp |
RefSeq ORF | 435 bp |
Locus ID | 11782 |
UniProt ID | Q9WVL1 |
Cytogenetics | 12 B3 |
Gene Summary | This gene encodes the sigma subunit of the adaptor-related protein complex 4 which mediates intracellular membrane trafficking along the endocytic and secretory transport pathways. This complex contains four subunits, beta, epsilon, mu, and sigma, and belongs to a family of five adapter protein complexes, including three clathrin-associated complexes and two non clathrin-associated complexes, that localize to different intracellular compartments and mediate membrane vesicle trafficking using distinct pathways. In humans, loss-of-function mutations in this gene have been linked to specific adapter complex 4 deficiency disorders including hereditary spastic paraplegia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) uses two alternate splice sites in the 3' coding region, compared to variant 1, resulting in a novel 3' coding region and longer 3' UTR. It encodes isoform 2 which has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200941 | Ap4s1 (tGFP-tagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1) |
USD 350.00 |
|
MR200941 | Ap4s1 (Myc-DDK-tagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1) |
USD 150.00 |
|
MR200941L3 | Lenti ORF clone of Ap4s1 (Myc-DDK-tagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1) |
USD 450.00 |
|
MR200941L4 | Lenti ORF clone of Ap4s1 (mGFP-tagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review