Trem2 (NM_031254) Mouse Untagged Clone

SKU
MC205819
Trem2 (untagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2), (10ug)
  $450.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Trem2
Synonyms Trem; TREM-2; Trem2a; Trem2b; Trem2c
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC033485
CCCACGCGTCCGGCAAGATCTTGCACAAGGTCCCCTCCGGCTGGCTGCTGGCAAAGGAAAGGTGCCATGG GACCTCTCCACCAGTTTCTCCTGCTGCTGATCACAGCCCTGTCCCAAGCCCTCAACACCACGGTGCTGCA GGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACGCAAG GCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC TGGCCTTCCTGAAGAAGTGGAATGGGAGCACAGTCATCGCAGATGACACCCTTGCTGGAACCGTCACCAT CACTCTGAAGAACCTCCAAGCCGGTGACGCGGGCCTCTACCAGTGTCAGAGTCTCCGAGGCCGAGAGGCT GAGGTCCTGCAGAAAGTACTGGTGGAGGTGCTGGAGGACCCTCTAGATGACCAAGATGCTGGAGATCTCT GGGTCCCCGAGGAGTCATCGAGTTTCGAGGGTGCCCAAGTGGAACACAGCACCTCCAGGAATCAAGAGAC CTCCTTCCCACCCACCTCCATTCTTCTCCTCCTGGCCTGCGTTCTCCTGAGCAAGTTTCTTGCAGCCAGC ATCCTCTGGGCTGTGGCCAGGGGCAGGCAGAAGCCGGGAACACCTGTGGTCAGAGGGCTGGACTGTGGCC AAGATGCTGGGCACCAACTTCAGATCCTCACTGGACCCGGAGGTACGTGAGAGAATTCTGAGTGGGAGGA GAACTACAGCTTAAGTCCAGCCAGGAGTCAATCCAGCCTGCATGCTCTCCCCTCCTCCACCAAGACTTCT GTTTCTGCTACTTTTGCTTCAGAGGCCGCCTCTGCCTCAAGCCCACCTATCCTGGGAGCAGGAATACTGG TGTGTACATCTGTGTTGAGTGGGGAAGACAGCTGGATGGTTGTCTGTCAACTTCTGCACTTTGGACATTA AACATTCTCCACACCCCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_031254
Insert Size 684 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC033485, AAH33485
RefSeq Size 1024 bp
RefSeq ORF 684 bp
Locus ID 83433
UniProt ID Q99NH8
Cytogenetics 17 C
Summary The protein encoded by this gene is part of the immunoglobulin and lectin-like superfamily and functions as part of the innate immune system. This gene forms part of a cluster of genes on mouse chromosome 17 thought to be involved in innate immunity. This protein associates with the adaptor protein Dap-12 and recruits several factors, such as kinases and phospholipase C-gamma, to form a receptor signaling complex that activates myeloid cells, including dendritic cells and microglia. In humans homozygous loss-of-function mutations in this gene cause Nasu-Hakola disease and mutations in this gene may be risk factors to the development of Alzheimer's disease. In mouse mutations of this gene serve as a pathophysiological model for polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease) and for inflammatory bowel disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. provided by RefSeq, Jan 2013
Transcript Variant: This variant (1) encodes isoform 1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_031254" in other vectors (6)
SKU Description Size Price
MG202717 Trem2 (tGFP-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$650.00
MR202717 Trem2 (Myc-DDK-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$450.00
MR202717L1 Lenti ORF clone of Trem2 (Myc-DDK-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$750.00
MR202717L2 Lenti ORF clone of Trem2 (mGFP-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$750.00
MR202717L3 Lenti ORF clone of Trem2 (Myc-DDK-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$750.00
MR202717L4 Lenti ORF clone of Trem2 (mGFP-tagged) - Mouse triggering receptor expressed on myeloid cells 2 (Trem2) 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products