Rnf5 (NM_019403) Mouse Untagged Clone

CAT#: MC205731

Rnf5 (untagged) - Mouse ring finger protein 5 (Rnf5), (10ug)


  "NM_019403" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rnf5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rnf5
Synonyms 2410131O05Rik; AA407576; NG2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC016449
GTGTGCCTGTGTGTGTGCCCTGTGTTAGTGTATATGTGTGTGTGCCTGGGGGTACTGAGGGCTACGTGGG GGCGAAGCAGAACTTGCCATGGCAGCAGCGGAGGAAGAAGACGGGGGCCCCGAAGGGCCAAATCGCGAGC GGGGCGGGGCGAGCGCGACCTTCGAATGTAATATATGTCTGGAGACAGCTCGCGAAGCTGTGGTCAGCGT GTGTGGCCACCTGTATTGTTGGCCCTGTCTTCACCAGTGGCTGGAGACCCGGCCAGACCGGCAAGAATGC CCGGTGTGTAAAGCTGGCATCAGCAGGGAGAAGGTCGTCCCTCTTTATGGGCGAGGGAGCCAGAAGCCAC AGGATCCCAGATTGAAAACTCCACCCCGCCCTCAGGGCCAGCGACCAGCTCCAGAGAGCAGAGGGGGGTT CCAGCCATTTGGTGATGCCGGGGGATTCCACTTCTCCTTTGGTGTCGGTGCCTTCCCCTTTGGCTTTTTC ACCACCGTGTTCAATGCCCATGAACCTTTCAGAAGAGGCGCAGGTGTGGATCTGGGACAGGGTCACCCAG CCTCCAGCTGGCAAGATTCCCTATTCCTGTTCCTCGCCATCTTTTTCTTTTTCTGGCTGCTCAGTATTTG AGCTCTGTCTCCTCCCTGCCCACCTCCAGCTAGAGGAGAATCAGTATTGGGAGTCCTGTGCTGGCCTTTC CTTGCTTTTGGACCACCCCCTTACTTCCATGACCCATCTCTGTCTGCTGAGGCCTCTCTCTTGGGAGGGC ATGGCGAGGAGTGACCAGTCTGCTTAAGATGGGAGTGCCTGCTGCTGTGTACTGCTGGCCCAGTAGCACA GACACTGTCAGCCTGGAGGACGGACAGACAGACAGGTGTCCAGTTCTCCCAATCCTTTGCTTTCCCCCAG ATTTCTTGATTTGGTGTTTAAAGGTGGGCTCTCCCCAACTCCTCTACTTGACTTAATTTAATTTTTCTCT ACCCACTGTCTAATATGAATTTTGACTCTTGAAGTGTCTCTTTCCATCCCTCACTACCTCCTTTAATTAC AAATTCAAATAATAATAATAATAATAAAAATAAAAATAAAGGTGAAACACGAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019403
Insert Size 543 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016449, AAH16449
RefSeq Size 1119 bp
RefSeq ORF 543 bp
Locus ID 54197
UniProt ID O35445
Cytogenetics 17 18.18 cM
Gene Summary Has E2-dependent E3 ubiquitin-protein ligase activity. May function together with E2 ubiquitin-conjugating enzymes UBE2D1/UBCH5A and UBE2D2/UBC4. Mediates ubiquitination of PXN/paxillin. May be involved in regulation of cell motility and localization of PXN/paxillin. Mediates the 'Lys-63'-linked polyubiquitination of JKAMP thereby regulating JKAMP function by decreasing its association with components of the proteasome and ERAD; the ubiquitination appears to involve E2 ubiquitin-conjugating enzyme UBE2N. Mediates the 'Lys-48'-linked polyubiquitination of TMEM173 at 'Lys-150 'leading to its proteasomal degradation; the ubiquitination occurs in mitochondria after viral transfection and regulates antiviral responses.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.