Misp (NM_030218) Mouse Untagged Clone

CAT#: MC205726

Misp (untagged) - Mouse RIKEN cDNA 9130017N09 gene (9130017N09Rik), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Misp (NM_030218) Mouse Untagged Clone
Symbol Misp
Synonyms 9130017N09Rik
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC013508
GCTGCAGCCCTCACTGGGCATTTTCGCCAGGACTCTGCGGCACCTGGTCAGTGAGCCTGGAGGCCTCCAA CCCACAGAAGGAAGGTCACACACAAGACCCTTTGAGATGGATCGAGTGACCAGATACCCCATCTTCAGCA ACCCCCGCTCAGCACGTGTCACCAGCTTGGTACTGGATGAAGATACCAGCTACACCGTTGAGCTAGTGGG CGTGGGGCCTGAGGCTGGTTGGAGCCAGGGTGATCTGCAGGCCTGGTCCACTGAGTACCAGACCAGACCA GATGTAAAGAGAACAAACGTGTCTTCCAACAGACGCGTCTTCCTTGGCCAGCAGTCCCCGAGGTCACTGT ACTTGGAAGATGAGGATGAGGAGATAAAGTCTTATCACCTGGACGACAGCAGTGACACCCTCTGCAGGCA GCGGAGGGAGCTGGAGGCTGAGCGCTGGGCAGTCATCCAGAGCCAGGCAGTCAGGAAAGGTGGCACAGTG GCCACACTCCAGGCTGCATCAGACCATGGGGACCTCAGGATTGCCAGACAACCTCAGTCCACAGTCACAG AGGAGATCTTGGTGGACACGGAGCAAATTGATTTCCTGGCTGCTCGACAGCAATTCCTGAGCTTAGAAAA GGCAAACACAAACCCGGTCCCCTGCGGCCTCACAGCCAGGGAGACCTTCCCACGAACCCCACCAGGCATC AACCAAGCCCCCAAGGCTTCCACTGGGCCCCACCTAGCCAATGGCTATACCACTGCCGTCACGTCACCAA TGAAGGAAGTGACCCTGGAGAAGTCTTTCCATGTTTCCCCAGCTAGATCCATCCATATAGTCAATGATCC TGGCAGTCAGACCCAGGCAGAATCCCCTGAGACCCCCAAAGAGACGCCCATCGAGAGAGAGATCAGGCTG GCCCAGGAGCGAGAGGCAGAGCTGAGGGAGCAGAGAGGGCTTGGGCGAGCTGCCGGGCATCAAGAGCTGG TACAGATCCCCAGCAGGCCACTGCTCAGCAAGATGAGCTTGACAGAGACACCTCCACGAAGAGACAGGGG CCGCCCATCCCTCTATGTGCAAAGGGACATGGTGCAAGAGACACAGCGGGAAGAAGATCATCGACGAGAG GGGCTGCAGGTGGGCAGGGCATCCACACCTGACTGGCCTTCCCAGGACCCTCAGCCTGGGCTCCAGAGAA GCCTGAGCTCCGATTGCATCCTCAGCCCAGATGCCCGAGCCACAGACCCGGCTCCAGAGGCAAGGAAAGT CAACCGGATCCCACTGGATGCCTACCAGCCATATCTAGGCCCTGGGACCCCTAAACTAGAATTCTCAGCC TTTGGAGTATACAGCAAGCCAAGTGGTGTCTCCACCGAAGACACCAAAGCCACAGTCTTCCAGAAGGCCA CGGAGTCTCCAAGGCATGTCTCAGAATCCTCCGGCAGATCGCTGAGCTCAAAGCAAGAGTGGTCCAAGCC TCCTGGAAAAGCTACCAACGTGGGTGTGGTGAGATTAGGGAATTTCCACCTGCGTCCACTGCGATTCAAG GTCCCAGATGTCCCCCAGGGGACTGAGACCCCCCATACCTGGGGCTGGGAAGTGGCTGGAGGCCCCATAT TGAGGCTACAAAAGTCACAGTCATCTGACCTGCTGGAGAGGGAAATGGAGAGTGTCCTGCGGAGGGAGCG GGAGGTGGCTGAAGAGCGGAGGAATGCTTTCTTCCCAGAGGTGTTCTCCCCAGTGCCAGCCGAGGATGAG AGCCATGAGCAAGACTCCCGGAGTTCCTCCCGGGCATCTGGCATCACTGGCAGCTATTCAGTGTCAGAAT CACCACTCTTCACCCCCGTCCACCTGAATTCGGGGCTGGTGTGGAAGGTGGAGGCCCCTGAGGACAGTGC TCCCCCAGGGCAGAAGACTAGGAAGGAGATGTGGTATGCAGGTATCAACCCCTCAGACAGTGTCAACTCA GAGGTCCTGGGAGCCACAAGGGTAAAGCGGCACAAGAATCTCTTGGCGGAACGCTGGGAAGCACACATCT ATGCCAGCGAGGATGAAAACTGAGACTGGAAGCAGGGGGCCATTCTCCTGCCTCACTGCAGTCCTGTGGA GGCCGCTAGACCTGCCCCCAGTCTCTGCTGTCCCTATTTAAACATACAGCCCAGGCTGATGTTTGTGGCC TGCAGTTGATTTGGTTTTCCCTGGGGTGGGCGAGTGATTCGTGCTTAGGGGTGGTTCTCAGCTAAGGCTG AAATGATAATCCACCGATCCCCCTCACATCCCTCAGCCCTCCGCACAGCCCAGAGCTTGGATCTGTCACT GCAGAAAGAAGGCTCTGTTTGGGGACCTGCCATTCCACTCTTGCCAACCCCAAACGTATGCCTGTTGCTA TGAAATAAACCTGTCCTGAACTGCCTGCCTGGAGCAGAGGATGTGTCGCAGGCAGCCCCCGCCAAAAAAA AAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_030218
ORF Size 1947 bp
Insert Size 1947
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC013508, NP_084494
RefSeq Size 2461
RefSeq ORF 1947
Locus ID 78906
Cytogenetics 10|10 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.