Dnph1 (NM_207161) Mouse Untagged Clone

CAT#: MC205451

Dnph1 (untagged) - Mouse cDNA sequence BC048355 (BC048355), (10ug)


  "NM_207161" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dnph1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dnph1
Synonyms C76683; Rcl
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC048355
GCGCGCGGCGATGGCGGCATCCGGGGAGCTGGTTCCATGCTCTGTGTACTTCTGCGGGAGCATCCGCGGC GGGCGGGAGGACCAAGCTCTGTATTCGCGGATCGTATCCCGGCTGCGGCGCTATGGGAAGGTGCTCACTG AGCACGTGGCTGATGCTGAGTTGGAGCCGCGTGGGGAAGAGGCTGCTGGGGGCGACCAGTTCATCCATGA GCGGGACCTGGCCTGGCTCCGGCAGGCCGATGTGGTCGTGGCAGAAGTGACACAGCCATCCCTGGGTGTT GGCTACGAATTGGGCCGGGCAGTAGCTCTTGGTAAGCCGATCCTGTGCCTGTTCCGACCACAGTCTGGCC GAGTGCTTTCCGCCATGATCCGGGGAGCAGCCGATGGCTCGAGGTTCCAGGTGTGGGACTACGCAGAGGA AGAAGTGGAGACCATGCTCCATCAGTACTTTGAGGCTTATCTTCCTCAGGGGACGGCTTCCTCCAGTAAC CCAAGTGCCTGTCTTAACCCTACTGTATTAGAAAACATTTAAGATTTATTTTTTTAACCCAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI     
ACCN NM_207161
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC048355, AAH48355
RefSeq Size 565 bp
RefSeq ORF 522 bp
Locus ID 381101
UniProt ID Q80VJ3
Cytogenetics 17 C
Gene Summary Catalyzes the cleavage of the N-glycosidic bond of deoxyribonucleoside 5'-monophosphates to yield deoxyribose 5-phosphate and a purine or pyrimidine base. Deoxyribonucleoside 5'-monophosphates containing purine bases are preferred to those containing pyrimidine bases.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.