Gpsm2 (NM_029522) Mouse Untagged Clone

CAT#: MC205426

Gpsm2 (untagged) - Mouse G-protein signalling modulator 2 (AGS3-like, C. elegans) (Gpsm2), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpsm2 (NM_029522) Mouse Untagged Clone
Symbol Gpsm2
Synonyms 6230410J09Rik; LGN; Pins
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC021308
CCACGCGTCCGCTGGCCCAGGACACAATAATTTCCCATTTTCTCAGCTTATAATATGACTGGATGGAGGG AAATTTGATAAGCATGAGGGAAGACCATTCCTTTCATGTCCGCTACAGAATGGAAGCTTCTTGCCTTGAG CTGGCCTTGGAAGGAGAACGTCTATGTAAATCAGGGGACTGCCGCGCTGGCGTGTCATTTTTTGAAGCCG CAGTTCAAGTTGGAACTGAAGACCTCAAAACACTCAGTGCTATTTACAGCCAACTGGGCAATGCTTACTT CTACTTGCATGACTACGCCAAAGCGTTAGAATACCACCACCATGACTTAACTCTTGCACGGACTATTGGA GACCAACTTGGGGAAGCTAAAGCCAGCGGCAATCTCGGAAACACCTTAAAGGTGCTTGGGAATTTTGATG AAGCGATAGTGTGTTGCCAGCGACACCTGGATATCTCCAGAGAGCTTAATGACAAGGTGGGAGAAGCAAG AGCGCTCTACAATCTTGGAAATGTCTATCACGCCAAAGGGAAAAGCTTTGGTTGCCCGGGTCCGCAGGAT ACAGGAGAGTTTCCAGAAGACGTGAGAAATGCCCTACAGGCAGCTGTGGATCTCTATGAGGAAAACCTGT CCTTAGTAACTGCTCTAGGTGACCGAGCAGCACAGGGGCGAGCCTTTGGGAACCTTGGCAACACACACTA CCTCCTCGGCAACTTCAGGGATGCAGTTATAGCTCACGAGCAGCGTCTCCTAATTGCAAAGGAGTTCGGA GATAAGGCGGCTGAGAGAAGAGCGTACAGCAACCTAGGAAATGCATACATATTCCTGGGTGAATTCGAAA CTGCTTCCGAATACTACAAGAAGACACTGCTGCTGGCTCGGCAGCTTAAAGACAGAGCCGTGGAAGCTCA GTCTTGCTACAGTCTTGGGAATACATACACTTTGCTTCAGGACTACGAGAAGGCCATCGATTACCACCTA AAGCACTTAGCAATCGCCCAAGAGCTCAAGGATCGGATTGGTGAAGGAAGAGCGTGTTGGAGCTTAGGAA ACGCATACACAGCTCTGGGAAATCATGACCAAGCAATGCATTTTGCTGAAAAGCACTTGGAAATTTCAAG AGAGGTTGGGGACAAAAGTGGTGAACTGACTGCGCGGCTGAACCTCTCAGACCTGCAGATGGTTCTTGGT CTGAGCTACAGCACAAATAATTCCATGATGTCTGAGAACATTGAAATTGATGGCAGCTTACATGGTGCAG GCGCCAAGCTGGGACGGAGACACAGTATGGAGAACTTGGAACTTATGAAGTTAACACCAGAAAAGGTGCC GAATTGGAACAGTGAAATTCTCGCTAAACAGAAACCTCTCATTGCCAAACCATCTGCAAAGCTCCTGTTT GTCAACAGACTGAAGGGCAAAAAGTACAAAAGCGGCAGCGCCTGCACTAAGGTTCTCCAAGACGCCAGCA ACTCCGTGGACCACCGCGCGCCACGCTCCCAGAAGAAAATCAGTTCAGACACGATTGGAGATGAAGGATT CTTTGACTTGCTAAGGCGATTTCAGAGCAACAGGATGGATGACCAGAGGTGCCACTTACAAGGAAACTGT CGCACAACATCCACAGCAGCTGCTTCTGCTACCCCCAAGTTGATGAAAGCACCGTCTGTCTCTGTGGTGT CCCCCAACACAGATGAGTTCTTAGATCTTCTTGCTAGCTCACAGAGCCGCCGTCTGGATGACCAGAGGGC CAGTTTCAGTAATTTGCCAGGGCTCCGCCTGACAAAAGGCAACAGTCCATCTGTACTTGAGCGCCTGATG ACAAATGACAAGAAAGAGCCTGATGAAGACTTCTTCGACATCCTTGTAAAGTGCCAGGGGTCAAGATTAG ATGATCAAAGATGTGCTCCTCCATCTGCTGCCACTAAGGGGCCGACTGTCCCGGATGAGGACTTCTTTAG CCTCATCTTACGCTCTCAAGCTAAAAGAATGGATGAGCAGAGAGTTCTGCTGCAAAGAGATCCAAACAGA GACAGTGAGTTTGGACTAAAGGAACTTTTGCAAAATAACGCTTTGTTGGAATTTAAGCATTCGGGAAAAT AACTAGCAAACCACAGGATGGTGTGGTAACCTACTGAAGAAAAGGACTGGTCCCCTCAGGACACTGCAGG GAGCTCGCCACTGTAGCAGTCACCACATTTTTAGGGTGTGAATGTTGAGTACTGAGGGACTGACATTCTT CTGTCTCAGGGCAGAACGTCCTGTAAGGTGCTCCGTCAGCTTAACTGACCTTGAGATTCTGTGTGCGTGA CTAGATTCCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTTTCT TACAGAGGCCATCTTTAAGGAGCTAGTTGACAGGGACTTTTTGTACCTGCCCATGAATATAGCAGATTGC ATTGTTTATTGGAAATAATGTAAATGTCCTATGTAAAAAAGATGAAAATAGTCATAAAATTCTAGTTTAA GAAAACTATATTCAATATATTTTTAGGCAAAGCCAGTGAGGGAAATGAGAAATAAACTGCTTTTAGCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_029522
ORF Size 2019 bp
Insert Size 2019
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC021308, NP_083798
RefSeq Size 2673
RefSeq ORF 2019
Locus ID 76123
Cytogenetics 3|3 F3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.