Zmat4 (NM_177086) Mouse Untagged Clone

CAT#: MC205304

Zmat4 (untagged) - Mouse zinc finger, matrin type 4 (Zmat4), (10ug)

  View "NM_177086" in other vectors (6)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Zmat4 (NM_177086) Mouse Untagged Clone
Symbol Zmat4
Synonyms 9630048M01Rik
Vector pCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC065110
AGCTGCTGAAAGGTCTGGTCGCAGAGACAGGAACGCAGCATCCTCAGCGTGCTCCATCCCGGCAGTGTCT TCCTGCGCTCCGCCGGGCGGCGAGCCTCCGGACGACAGCCCCTCTGCTTCTCGGAGAAGCCTGATGAAGT CCTCCGATATCGATCAGGATTTATTTACAGATAGCTACTGCAAGGTGTGCAGCGCACAGCTGATATCCGA GTCCCAGCGGGTGGCCCATTATGAGAGTCGAAAACATGCCAGCAAAGTCCGGCTGTATTACATGCTTCAC CCCAGGGATGGTGGGTGTCCTGCCAAGAGGCTCCGAGCAGAAAATGGAAGCGATGCTGACATGGTGGATA AGAATAAATGCTGTACACTCTGTAACATGTCCTTTACCTCAGCTGTGGTGGCCGACTCACATTACCAAGG CAAAATCCACGCCAAAAGGTTAAAACTGTTGCTAGGAGAGAAACCTCCACTGAAAACCACAGCCGCTCCG CTGAGCTCACTTAAGGCTCCTCGAGTGGATACGGCCCCCGTGGTCGCATCTCCCTATCAAAGAAGAGACT CAGACAGGTACTGCGGTCTCTGCGCAGCCTGGTTTAACAATCCTCTGATGGCCCAGCAGCATTACGAAGG CAAGAAACACAAAAAGAACGCAGCCCGCGTTGCCTTGCTAGAGCAGCTCGGAACATCTCTGGATCTGGGA GAACTGAGAGGTCTGAGACGTACTTACAGATGTACCACGTGCAGTGTGTCGCTCAACTCCATAGAACAGT ATCATGCACATCTGCAAGGATCAAAACATCAGACCAACCTGAAGAATAAGTAGTGACAGCATCTATCAAG AGCTAAGAAGAGACTCCCGCATTTCTCTGTGGTAGAGAACTGCTCACCAACCAAAGGAGGATCCTTTCTC AAGCAATGAACATTTCTTACAAGGATTCACAGATTAACACGTGACCAGTATTGATTTTTGAAAGTAAATA AGATTTCCTTTTCTTCTTCTCATTTAGTGGCAAATTATCCTTGGATTTAGAAGAATCCTTTTCTGATAAC ATTGTTTAGCACAAGTTCTAAACTGCAATCACACACACAGCAGCTAGTCAGAGCATTATTCAAACTTACA ATGAGTGGAAAATTTAATTTCCAATTCATTCTAGATTTCCGTAGAGTTACAATGATTCTGTGAGACCCTT CATGATTATCATGTAAGCCTCCTAGATCCATTAACAAATATACTTTTGTCATCATGGGGAACATAGTTGG TGACGCCAACCACAAGAACAGAGCAAATTGTGGTCTGTAGAAGTTATATAACAAATAGAATACCAGTCCT TCCTGCTTCACACCTATGAGCCAGCCTTGCCTCTAAATGCCAGGAGCGTGAAAGCAGGTGGGAACACAGA GGAAGGACCTTCACTCTGGATCACCTTGATGGAAAGCTTCACAAGACGAAGCCAAGTTCTCCTTGCAAGC TGCCAGATCATAGCTTAGGAAAAGAACTAGTTTTGATTGCATGATGATCCTATTAAGTAAAAATGTCTTC ACAGCGGTTGACCTTGATGGAGTGCTTTTGTAAAGGTATCCAAAGGAGAATTTTAAACCCCAGAGTGAGA TGGAAGTAATTCTTAGCAAGTTGGCCTGGATTGTGGGCTTTAATTTGGGGCAGTAATGATTTGGTGTGTG TCAAGGGAGGGAAGAGAATGATTAAATCCTGAAGAAGTTTCCTTCTTCTGTTTCTCTTCCAACTTGTTGC CGAGCTGGGGATTGAGTGACTTTGAACAGAACTCTTCTGGGAAGAGGATGGACCAGAGAACTGATGCTCT TTAAAGGGATCAAGTTTGAGTGCAACTGTGAAATTCCCTCTCCAGGGAATCACTGCTCTGCATTGTGTTG GGAAGTGGTGTCTTGCAGACACTGCAAGGTAGACACAGAACTTCCTTTCCTGGGCTCTCAGCTGGCTGGA GCAGCCCTTGACAACTTGTGACCACCAAGCTACCAAGTAACGTCAGACTTTTCCAGACATCAGCGCCTTC CACAGAGATCTGAGGTCGTGGACAGCCAGTGAGCAATAAACGAAACGACACGGAAACGCACAGTGTTGTT CTTAAGGTGCCTGTTTTGTTGTGTGAGGAGGTCACGGTCCTTAGGGACCAGACCCGTGGCTGCAAAGAGG AAGGTCACACACACCGTGTACAGTCATGCTGCAGGTGGGAAGCACGAGGGGTGTGGTGACAACAATTTTA TTTTGCTATTTTAGAAAGAAGCACACAACAGAGCTACAGCCCTCCCGTGATGGCTTTTCTTCGAATATGT GGAATAAAGCTTTATTTGTCAATTCTGCTGTAAAATAAGCATAGTCTGAGGTTTTGGTTTTTGTTTTTAA AATCTTTCTCTGTTTCTGTTTAGTGCCTGAGCTCTCTCCCTGAAGTGTTGTGTTTATTTTTGTTTTTAAT GGCCTAAGATAGAAAAGCCTATGAACATAGATCTCCTTTGCATTACAGTGACACTTTGCCAAGTCCTTTA TGGCTAAGCCTCCAGCTACAATAATCAGATTATTTCAGAGTGCCTCATCGAAATACCATTGCTCTTTGGC AAGCTGCCACAGACACCTACCAGACATTTTCTTGGTTTGATTGTTCTCAAGTATATTCATGCCCATGCAG ATAAGGGGAGTGTCATCCCAGCACGCTGTGAGGATCACTTGGCCAGACTACTATCTGCAAGAAGGCTCAA CATGCCACTGTGTTCTGGAGACTATCTAACAGACACACCTTTCCTCCAGAAACTGGGCTGTTCACTTTTG CTTTAGTGTGGCTGTATGTTCAATGAAGTCTTATGTTAGTTTCCAGTTTTATTATGACTGGACAGGAGTT GGGTGTAGGGCAAATGTTTTTCAGGGGCCCTTGATTCTGATGGGAAGAAAAGAGACAAACCTGTCTGTGT CTCTGTCTCCTGACCAGTCCATGTGGAGCAACCCTGAGAGAGAGAGAGCAATGTGATTACAATAAGAACT TGGGGTTAGTTCTATATCATTTGAGGAGAACATGGAGAAAACTCATCTATGAGAGAGGAGAGCTGTCCAT ACGACTGTGTCTAAATTAACGTGGATATTTCAGAGTTCAGAGTGATGTCAGCTAACCACATTAAGTTTTC TGGCCATAATGAGAAAAACTCAACACCTATCGGCCTCCTGTTAAATCGAGATATCTCTGTTTAATGGAAC AGTCACTAGCGGTTGACCTAGGTATCTCCCTGTTTCTCTCCCTTCTCCTATCATTCCAGGATATAGTCTC CAGGATGTAACATGCATTGCCCATGTGGTCTACCACTGAATGCCATGCTTAGGTGTGATTCCTCAGAACA CTAGATCACCCCTTAGTCCTGGCCATACCATTTGAATTTGCTTTACAAAATCTTCTTCCCGTTCAGTACG GATATGAGCTTGAGGCTAGCAACCTGTGTCAGTGGCCACAAATGCCATGATAGTAAGATCCAAATTAATG AGCTCTCCTTATAGACAGTCTCCATAGTCCAGGGAACTAATAAATACACTCATAAAGCAATCCGCTAAGC AGCAAGTGCTGTGGCCATTCCTTCTGCTGATAAAGTAGCCATAAAACTTTCATCTATTGCTGCTGGACTG AAAGACCAATGGGATCTGTTCTTTTTGGCCCTTTAGATGACAGAGATGCATAAATTGGAACTGCAAGGAT CTTTGCACTGTCTGTTGGAGTAAATTTAATTAGGCCAACTGTATCAAAAAGAAAAAAACAAAAACAAAAA ACAATGGGACCCACTTATAATGCTGTCATTCCTGCGGAACTCCCCATCTAGAGAGGCCACCTTCCTGTCA AAGCTGAGTGAGGCATTTTTGACAAGGCAGTGGGAATACAGGACATTAAACCCCAATAAGAGACCACGAG GTTGTAAAGACAGTCCCCACTAAATATCTGTCCTTCTCTTGAACAGCTTGTCCAGTGAATTATTTTTCTT TTGTAAGAATAAAACTAAGAAAAGTCTGTCTGTGCAACATATTATTGTAGGGATGGATTTTTCTCCCCTG CCCCCTTCTGGTTTTGAATTTGTTCATATTCAAGGCATGTTAAACTACCTCATAGGTTTGTTGTGTGGAT TAGCTGATTAATAAATAACAACTGATTAAAATACGAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_177086
ORF Size 690 bp
Insert Size 690
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC065110, NP_796060
RefSeq Size 4183
RefSeq ORF 690
Locus ID 320158
Cytogenetics 8|8 A2

Other Versions

Other products for "Zmat4"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones