2410015M20Rik (NM_153152) Mouse Untagged Clone
CAT#: MC205295
2410015M20Rik (untagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik), (10ug)
"NM_153152" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | 2410015M20Rik |
Synonyms | Mic13; QIL1; sr104 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC056164
AGACTAACCATGGTGGCTCGAGTGTGGTCGCTAATGAGGTTCCTCATTAAGGGAAGTGTGGCTGGAGGAG CAGTCTACCTTGTTTATGACCAGGAGCTGCTGGGGCCTAGTGACAAGAGTGAGGCTGCCCTGCGGAAGGC CGAGGAGGTTGTGCCACCAGCAATGTACCAGTTCAGCCAATATGTGTGCCAGCAGACAGGTCTGGAGATG CCACAGCTCCCAACCCCTCCAAAGATTAAATTTCCAAACTTCCGTGATTCCTGGAACTCAGGCATCATCT CAGTCATGTCAGCCTTGTCGGTGGCCCCCTCCAAGGCCCGAGAATACTCCAAGGAGGGCTGGGAGTACCT CAAGGAACACAGCAAGTAATGGATGCCACCTGCCCCAGCATTATGGGGGTCAAGACCAGGATGGCAGAGA CATCCCAGTGGGGACCTCACTCTGAGGGCAGCTTCCAGCATTGCTGGCCCAATAAAGGACTTGGGAATGG TCAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_153152 |
Insert Size | 360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC056164, AAH56164 |
RefSeq Size | 517 bp |
RefSeq ORF | 360 bp |
Locus ID | 224904 |
UniProt ID | Q8R404 |
Cytogenetics | 17 D |
Gene Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Constituent of mature MICOS complex, it is required for the formation of cristae junction (CJ) and maintenance of cristae morphology. Required for the incorporation of MICOS10/MIC10 into the MICOS complex.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200557 | 2410015M20Rik (tGFP-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) |
USD 350.00 |
|
MR200557 | 2410015M20Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) |
USD 150.00 |
|
MR200557L3 | Lenti ORF clone of 2410015M20Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) |
USD 450.00 |
|
MR200557L4 | Lenti ORF clone of 2410015M20Rik (mGFP-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review