Hormad1 (NM_026489) Mouse Untagged Clone

CAT#: MC205141

Hormad1 (untagged) - Mouse HORMA domain containing 1 (Hormad1), (10ug)


  "NM_026489" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Hormad1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hormad1
Synonyms 4921522K05Rik; Nohma
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC051129
CACTTCAAGACTCTTGCCTGTCGCTGCCGGACGCTTCCCTCAGGCGGTGCGTAAAAAAATATTTCTTGGA AGATGGCCACTATGCAGTTGCAGAGGACAGCTTCCCTGAGTGCATTGGTATTTCCCAATAAGATATCAAC TGAGCATCAATCTTTGATGTTTGTGAAGAGGCTCCTAGCTGTTTCAGTATCTTGCATCACCTATTTGAGA GGAATATTTCCAGAACGTGCTTATGGGACAAGATATCTGGATGATCTCTGTGTCAAAATTCTGAAAGAAG ATAAAAATTGTCCAGGTTCTTCACAGCTAGTGAAGTGGATGCTTGGATGCTATGATGCTTTACAGAAGAA ATATCTAAGGATGATCATTCTAGCTGTATACACCAATCCAGGAGATCCTCAGACAATTTCAGAATGTTAC CAGTTTAAATTCAAGTACACCAAAAATGGACCAATCATGGACTTTATAAGCAAAAATCAAAACAATAAAT CTAGTACAACATCTGCTGACACCAAGAAAGCAAGTATTCTCCTCATTCGGAAGATTTATGTCTTAATGCA AAATCTAGGACCATTACCTAATGATGTTTGTCTGACCATGAAACTTTTTTACTATGATGAAGTTACACCC CCAGATTACCAACCACCAGGTTTTAAGGATGGTGACTGTGAAGGAGTAATATTTGATGGGGACCCTACAT ACTTAAATGTGGGAGAAGTCCCAACACCTTTTCACACCTTCAGATTAAAAGTGACCACTGAGAAGGAACG AATGGAAAATATTGATTCAACCATACTAAAACCAAAAGAATCAAAAACACAATTTGAAAAAATTCTAATG GACAAAGATGATGTGGAAGATGAAAATCATAATAATTTTGACATTAAAACTAAAATGAACGAACAGAATG AAAACTCTGGAGCTTCTGAAATCAAAGAACCAAATTTAGATTGTAAGGAAGAAGAAACTATGCAATTCAA AAAGAGCCAAAGTCCTTCAATTTCTCATTGTCAGGTTGAACAGTTAGTCAGTAAAACATCTGAACTTGAT GTGTCTGAAAGCAAAACAAGAAGCGGAAAAATCTTTCAGAGTAAAATGGTAAATGGAAATAATCAACAAG GACAAACTTCTAAAGAAAATCGGAAGAGAAGTCTTCGTCAATTTAGGAAAACAATAAATGCACCTGAGTG TAGGTGACAAACAAGATGCCCTGGACTTGGAGTTAAAGGTCCTTCACGTCTTGGAATCTAGTCAAGAGTC AGTGCTGAAGAAAAGGAGAGTTAGTGAACCAAAGGAACATACCTAAAAATTATTTTTCTTATGCAAATTT GCAGTTCTCAACATTTAAACTAATATGCTGTATTATTTGAAGGTGTGCCTTCTGTACCTCTGAAAATTAT TTTGTAGTTCATAGTTATTAAACTAATAAAAGTTTTAGCTAGTAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA
Restriction Sites SfiI-SfiI     
ACCN NM_026489
Insert Size 1125 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC051129, AAH51129
RefSeq Size 1473 bp
RefSeq ORF 1125 bp
Locus ID 67981
UniProt ID Q9D5T7
Cytogenetics 3 F2.1
Gene Summary Plays a key role in meiotic progression (PubMed:19686734, PubMed:21079677, PubMed:21478856). Regulates 3 different functions during meiosis: ensures that sufficient numbers of processed DNA double-strand breaks (DSBs) are available for successful homology search by increasing the steady-state numbers of single-stranded DSB ends (PubMed:19686734, PubMed:21079677). Promotes synaptonemal-complex formation independently of its role in homology search (PubMed:19686734, PubMed:21079677). Plays a key role in the male mid-pachytene checkpoint and the female meiotic prophase checkpoint: required for efficient build-up of ATR activity on unsynapsed chromosome regions, a process believed to form the basis of meiotic silencing of unsynapsed chromatin (MSUC) and meiotic prophase quality control in both sexes (PubMed:21478856).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, and in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 2, 3, and 4 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.