Actl6b (NM_031404) Mouse Untagged Clone

CAT#: MC205132

Actl6b (untagged) - Mouse actin-like 6B (Actl6b), (10ug)


  "NM_031404" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Actl6b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Actl6b
Synonyms Actl6; ArpNa; Baf53b
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC049539
GGGATCCCGGGAGCTGTCCGGCCGCCTCGGTGCTGATCCCGCCGCCGCCCACGGGCCGCGAGCAGCGTAG AGAGGGCACTATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTCGTCTTTGACATTGGCTCT TTCTCAGTCCGAGCTGGGTACGCTGGGGAGGACTGCCCCAAGGCTGACTTCCCCACCACTGTGGGGCTGC TGGCCGCAGAAGAGGGGGGCGGGCTGGAGCTGGAGGGGGAGAAAGAGAAGAAAGGGAAGATTTTCCACAT CGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAGGTCATGTCGCCCCTCAAGAATGGCATGATT GAGGACTGGGAGTGCTTCCGAGCCATCCTGGATCATACCTACAGCAAACATGTCAAGTCCGAGCCAAACC TGCACCCAGTACTCATGTCGGAGGCTCCGTGGAACACTCGGGCCAAGCGGGAGAAGCTGACGGAGCTGAT GTTCGAGCAGTACAACATTCCTGCCTTCTTCTTATGCAAGACGGCCGTGCTCACAGCCTTTGCAAATGGA CGCTCCACAGGCCTGGTGCTGGACAGTGGGGCCACCCACACTACAGCCATCCCAGTCCATGATGGCTATG TCCTACAGCAAGGCATCGTCAAGTCCCCCCTGGCAGGGGACTTCATCTCCATGCAGTGCCGGGAGCTCTT CCAGGAAATGGCTATTGATATCATTCCTCCTTACATGATTGCAGCCAAGGAGCCTGTACGGGAGGGAGCC CCCCCAAACTGGAAGAAGAAGGAGAAGCTACCCCAAGTCTCCAAGTCCTGGCATAACTACATGTGTAACG AGGTGATCCAAGACTTCCAGGCCTCCGTACTGCAGGTGTCTGATTCCCCTTACGATGAACAGGTAGCTGC ACAAATGCCCACTGTGCATTATGAAATGCCCAATGGCTACAACACAGACTACGGCGCTGAGCGACTTCGA ATCCCTGAGGGCCTGTTTGATCCCTCTAATGTCAAGGGCCTGTCCGGGAATACCATGCTAGGAGTGGGTC ACGTGGTCACCACCAGCATCGGCATGTGTGACATTGACATTCGCCCGGGTCTCTATGGCAGTGTCATTGT CACTGGCGGCAACACTCTGCTTCAGGGGTTCACAGACAGACTTAATCGGGAGCTTTCTCAGAAGACCCCA CCGAGCATGCGTCTTAAGCTCATCGCCAGCAACAGCACCATGGAACGCAAGTTCAGCCCCTGGATTGGAG GCTCCATCTTGGCCTCACTGGGCACATTCCAGCAGATGTGGATCTCCAAACAGGAATACGAGGAGGGAGG GAAGCAGTGCGTGGAGCGGAAGTGCCCCTGAAGTTGCCCCCCTCCCCCAAATACCCGTCCACCCCATCCA CGGAGAAACGCCAGAGGGGCGTTCTACCAGCCAGAAATCCAAAAGCGCTGAACTCTCCCTTTCCCATTAC CCTCTTCTCTCTTACCCACATCTTCTTAGACTGTGATGTTCCTGAGTTGAAAGAAGAAAAAAAAAAAAGA ACTTTTATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_031404
Insert Size 1281 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC049539, AAH49539
RefSeq Size 1579 bp
RefSeq ORF 1281 bp
Locus ID 83766
UniProt ID Q99MR0
Cytogenetics 5 G2
Gene Summary Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Belongs to the neuron-specific chromatin remodeling complex (nBAF complex), as such plays a role in remodeling mononucleosomes in an ATP-dependent fashion, and is required for postmitotic neural development and dendritic outgrowth. During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. ACTL6B/BAF53B is not essential for assembly of the nBAF complex but is required for targeting the complex and CREST to the promoter of genes essential for dendritic growth.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.