Atraid (NM_212470) Mouse Untagged Clone

CAT#: MC205026

0610007C21Rik (untagged) - Mouse RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atraid
• Synonyms: 0610007C21Rik; AI316792; Apr3; HSPC013; p18
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC049637
  GAAAGCAGTGGGAAATGGCGTCTCGGGAGTCAGGCGGCTCTCGGGCGGCCGCCCTGCTCCTGGTTCTGGG CGTGGAGAGGGCCCTGGCTCTACCTGAGATATGCACCCTGTGTCCGGGAGGCTAGATCTTCAGAACTGTT CCCTGAAGGATCCTGGTCCAAACTTTTTACAGGCTTATACTGCTATTATCATAGACCTTCAGGCAAATCC TCTCAAGGATGATTTGGCCAACACCTTCCGTGGGTTTACTCAGCTGCAGACTCTGATACTACCACAAGAT GTTCCCTGTCCTGGAGGTAGTAATGCCTGGGACAATGTTACTTCTTTCAAGGACAAGCAGATTTGCCAAG GGCAAAGGGACCTTTGCAATAGCACTGGAAGCCCAGAAATGTGTCCTGAGAACGGATCTTGTGCATCTGA CGGTCCTGGTCTTTTGCAGTGCGTTTGTGCTGATGGTTTCCATGGATACAAGTGTATGAGGCAGGGCTCA TTTTCACTGCTTATGTTCTTTGGGATTCTGGGATCCACCACGCTAGCCATCTCCATTTTACTTTGGGGAA CCCAGCGCCGGAAAGCCAAGGCTTCATGAGCCACACAAGACTTCCAGCTCACCTGACTGCGCACCCTCAT CTATCAAGTCCCGGCCATGTCGCAGCCAAGAAGATTTACTTCGTTGACAATTACTGGCCAATGAGCAGAA CTGTTTAAGGCTGAAGCGGCCATTGATAATGAAAGGTGTCAAATTGCACCACCTCGGGGGTCTTGTGGAC ACTTGGTTCAGGAGTGGACTCGTACTAATTTGTATTATTGACTACAATAAACACCTTTTCCCCCGTTTTA AAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: SfiI-SfiI
• ACCN: NM_212470
• Insert Size: 489 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC049637, AAH49637
• RefSeq Size: 896 bp
• RefSeq ORF: 489 bp
• Locus ID: 381629
• UniProt ID: Q6PGD0
• Cytogenetics: 5 B1
• Gene Summary: Promotes osteoblast cell differentiation and terminal mineralization. Plays a role in inducing the cell cycle arrest via inhibiting CCND1 expression in all-trans-retinoic acid (ATRA) signal pathway (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct N-terminus, compared to isoform 1.