Nenf (NM_025424) Mouse Untagged Clone

CAT#: MC205024

Nenf (untagged) - Mouse neuron derived neurotrophic factor (Nenf), (10ug)


  "NM_025424" in other vectors (3)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nenf"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nenf
Synonyms 1110060M21Rik; SCIRP10; Spuf
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC048464
GCTCCTCGCTGTCTATGGCGCGCCCCGCGCCCTGGTGGCGGCTGCGGCTGCTGGCGGCGCTCGTCCTGGC GCTGGCTCTGGTCCCAGTGCCCTCAGCCTGGGCTGGGCAGACGCCGCGCCCCGCAGAGCGCGGGCCCCCG GTGCGGCTCTTCACCGAGGAGGAGCTGGCCCGCTACGGCGGCGAGGAGGAGGATCAGCCCATCTACTTGG CAGTGAAGGGAGTGGTGTTCGATGTCACCTCTGGGAAGGAGTTTTATGGACGAGGAGCCCCCTACAATGC CTTGGCCGGGAAGGACTCCAGCAGAGGTGTGGCCAAGATGTCACTGGATCCAGCAGACCTCACTCACGAC ACTACTGGTCTCACGGCCAAGGAGCTGGAGGCCCTCGATGACGTCTTCAGCAAGGTGTACAAAGCCAAGT ACCCCATTGTTGGCTACACAGCCCGAAGGATCCTCAACGAGGATGGCAGCCCCAACCTGGACTTCAAGCC TGAAGACCAGCCCCATTTTGACATAAAGGACGAATTCTGATGTCTAGCTGAGAAGCAGCCGGTTCTAGGG AGAAGTGAGGGGACAGGAGTTAAGTGTCCCTCGGAACAAGCGGAGGAAGCCTCCGAGTGCCCTGCAGCTG AATAAAGCGAATGTTTAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_025424
Insert Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC048464, AAH48464
RefSeq Size 681 bp
RefSeq ORF 516 bp
Locus ID 66208
UniProt ID Q9CQ45
Cytogenetics 1 H6
Gene Summary Acts as a neurotrophic factor in postnatal mature neurons, enhancing neuronal survival (PubMed:15605373). Promotes cell proliferation and neurogenesis in undifferentiated neural pro-genitor cells at the embryonic stage and inhibits differentiation of astrocyte (PubMed:16547973). Its neurotrophic activity is exerted via MAPK1/ERK2, MAPK3/ERK1 and AKT1/AKT pathways (PubMed:15605373, PubMed:16547973). Neurotrophic activity is enhanced by binding to heme (PubMed:18056703). Acts also as an anorexigenic neurotrophic factor that contributes to energy balance (PubMed:23576617).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.