Tcte3 (NM_011560) Mouse Untagged Clone
CAT#: MC204983
Tcte3 (untagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1, (10ug)
"NM_011560" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tcte3 |
Synonyms | D17Leh117c; LC2; Tcte-3; Tctex-2; Tctex-4; Tctex2; Tctex4 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC061136
AGGGCGGAGGGCGGAGGGCGGAGGCGTCCCGGTGAGCCGATCAAGATGGAGCGGCGAGGCCGAATGGCGA AGACGCCCACCGGCCAAACGCATCAATCCCCGGTGTCTAAGAGAGAAAGGAAGCCTAGCATGTTCGAGAA GGAGTCATATGCACAGATCTTAAGAGAAAGACTGAGAGAGTCTTTTCATGATGTTCAGTACGTGGAACCT CCGTTTGATGACTCAATTGCTGATGTAGGCAAAGAATGGAAAAGTGCCCTGGCAAAATTAAAGTTTGCTA ATTCATACAGAATGGAGCCACTGAAGAAATTTCAAGCACATTTGGTAGAAACTAAAATCCAGCAGATATT AAAGGACAGTCTTAAAGATGTCAAATATGATGACAAAGCCCCTCATTTGTCACTTGAATTGGCAGATCGA ATATTGGCAGCAGTCAAAGAATTTGCATACCATCGTTATAAATTCATTATACAAGTATTATTTATTCAAA AGACTGGTCAAGCAATAAATATTGCCAGCAGATGGATCTGGGATGTGGCATGGGACAACTGGGTAGAAGC TAAACATGAAACAGAGTCTTACGTGGTATTGGCCTTGGTGTTTGCTCTCTATTGTGAATAGCTCAGGACC AGCATTTTCACCCCCCATCCTTCAAAATAAATGATATATACAGAAAAAAAAAAAAAAAAGTAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_011560 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC061136, AAH61136 |
RefSeq Size | 721 bp |
RefSeq ORF | 576 bp |
Locus ID | 21647 |
UniProt ID | P11985 |
Cytogenetics | 17 8.95 cM |
Gene Summary | This gene is one of three genes with a very high degree of similarity to each other within a 77 kb genomic span on Chromosome 17 A2. This gene is the most distal copy of the three genes. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the longer transcript and it encodes the longer protein (isoform 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201829 | Tcte3 (Myc-DDK-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 |
USD 300.00 |
|
MR201829L3 | Lenti ORF clone of Tcte3 (Myc-DDK-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 |
USD 600.00 |
|
MR201829L4 | Lenti ORF clone of Tcte3 (mGFP-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review