Cdc42se1 (NM_001038708) Mouse Untagged Clone
CAT#: MC204960
Cdc42se1 (untagged) - Mouse CDC42 small effector 1 (Cdc42se1), transcript variant 2, (10ug)
Product Images
Frequently bought together (3)
Other products for "Cdc42se1"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cdc42se1 |
Synonyms | 1300002M12Rik; AW558204; Cdcse1; SCIP1; Spec1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC060964
GGCGGGCGGCGCAAGCCACGGAGAGGCAGGGAAGCGGCGACTGCAGCGTGGGGCCGGGTGGAAGGATTCC ACATCTAAAGAAGACAGGACCTTGTGCCTGCCTGCCCAAGCCTCTTGCCAGTGCCCCACCAGTCAGAGAC TCCGACCTTCACCGAAAGGCCACTTGTTGGTGTCTAGGATTTCTACCTTTTCCCACCCCATCCGGTTGAC TGAACCCAGGGTGTTGTTACACCTGCCTGTGAGGACTGGTTGGTTAGCAACAAACACGAGCCCCCTGGGG CCTCTGGCAGCGGCCTGAAGCTGGAACCATCAGGGAACATGAGCGAGTTTTGGCACAAACTGGGCTGCTG CGTGGTCGAGAAGCCCCAGCCGAAGAAAAAGAGAAGACGGATTGACCGCACTATGATTGGGGAGCCAATG AACTTTGTCCACCTGACTCACATCGGCTCTGGGGAGATGGGGGCTGGAGATGGACTTGCCATGACAGGTG CAGTTCAGGAGCAGATGAGATCCAAGGGAAACCACCGTGACAGACCGTGGAGCAATTCTAGGGCCTTGTA GCTCCCATGGGACTGGTTCTGCAGTCTTGGAGTTCCCATTCTGTGATTCTGTGTCCAGCCCAAAAGAAAT GCCACCACCAGATCCCTTCAACCAGTGACCCAAGGGCCCCCCCTCTTTCTCTCTAACAAGTGCCTCAAAA GGAGTGGGGGCTGGTCTCCCTTTTCTCCCTCTGGCCTCTGCCCCTCCTGGAGATGGGGGTCAAGGCAGCA GGACTGACCAAGTGACTACTGGTGGGCCAGAGGAGCTCCGCTGAAGCCCTGCACACCCTTGATCTGAGCT GGGGGTTCTCTGGGAACCTGGAATGGGTTCCTTGCTCCTGAATGAAGGTCGGGTGCTACCTGTAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_001038708 |
Insert Size | 243 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC060964, AAH60964 |
RefSeq Size | 933 bp |
RefSeq ORF | 243 bp |
Locus ID | 57912 |
UniProt ID | Q8BHL7 |
Cytogenetics | 3 F2.1 |
Gene Summary | Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.