Cdc42se1 (NM_001038708) Mouse Untagged Clone

CAT#: MC204960

Cdc42se1 (untagged) - Mouse CDC42 small effector 1 (Cdc42se1), transcript variant 2, (10ug)


Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cdc42se1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cdc42se1
Synonyms 1300002M12Rik; AW558204; Cdcse1; SCIP1; Spec1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC060964
GGCGGGCGGCGCAAGCCACGGAGAGGCAGGGAAGCGGCGACTGCAGCGTGGGGCCGGGTGGAAGGATTCC ACATCTAAAGAAGACAGGACCTTGTGCCTGCCTGCCCAAGCCTCTTGCCAGTGCCCCACCAGTCAGAGAC TCCGACCTTCACCGAAAGGCCACTTGTTGGTGTCTAGGATTTCTACCTTTTCCCACCCCATCCGGTTGAC TGAACCCAGGGTGTTGTTACACCTGCCTGTGAGGACTGGTTGGTTAGCAACAAACACGAGCCCCCTGGGG CCTCTGGCAGCGGCCTGAAGCTGGAACCATCAGGGAACATGAGCGAGTTTTGGCACAAACTGGGCTGCTG CGTGGTCGAGAAGCCCCAGCCGAAGAAAAAGAGAAGACGGATTGACCGCACTATGATTGGGGAGCCAATG AACTTTGTCCACCTGACTCACATCGGCTCTGGGGAGATGGGGGCTGGAGATGGACTTGCCATGACAGGTG CAGTTCAGGAGCAGATGAGATCCAAGGGAAACCACCGTGACAGACCGTGGAGCAATTCTAGGGCCTTGTA GCTCCCATGGGACTGGTTCTGCAGTCTTGGAGTTCCCATTCTGTGATTCTGTGTCCAGCCCAAAAGAAAT GCCACCACCAGATCCCTTCAACCAGTGACCCAAGGGCCCCCCCTCTTTCTCTCTAACAAGTGCCTCAAAA GGAGTGGGGGCTGGTCTCCCTTTTCTCCCTCTGGCCTCTGCCCCTCCTGGAGATGGGGGTCAAGGCAGCA GGACTGACCAAGTGACTACTGGTGGGCCAGAGGAGCTCCGCTGAAGCCCTGCACACCCTTGATCTGAGCT GGGGGTTCTCTGGGAACCTGGAATGGGTTCCTTGCTCCTGAATGAAGGTCGGGTGCTACCTGTAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_001038708
Insert Size 243 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC060964, AAH60964
RefSeq Size 933 bp
RefSeq ORF 243 bp
Locus ID 57912
UniProt ID Q8BHL7
Cytogenetics 3 F2.1
Gene Summary Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.