Gadd45gip1 (NM_183358) Mouse Untagged Clone

CAT#: MC204958

Gadd45gip1 (untagged) - Mouse growth arrest and DNA-damage-inducible, gamma interacting protein 1 (Gadd45gip1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gadd45gip1
• Synonyms: 2310040G17Rik; AI425883; Crif1; MRP-L59; Plinp1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC061069
  ACAGCCAAGATGGCGGCGCTCGCAATGCGGAGTGGCTATCTCCTGCGGCTCTCTGTGGCTCTGGGTCCCA GGTCCCGCAGCTACCGTGCGCCCCCGCCCCCGCGCCGCCGTCCCGGGCCCCACTCGCCAGACCCGGAGAA CCTGCTGACCCCGCGATGGCAGCTAACGCCCCGCTATGTGGCCAAGCAGTTCGGACGACATGGCGCCATC TCCGGGGTGCCCCCGGCCTCCCTGTGGCCCACCCCAGAGCAGCTGCGCGAGTTGGAGGCCGAGGAGCAAG AATGGTACCCGAGCTTAGCGACCATGCAAGAGTCGCTGCGCTTGCAGCAGCAGGCCTTGGAGGCAAGGCG CCAAGCCAGGGAGCAGCGTATCGCAGAGTGCATGGCCAAGATGCCACAAATGATTGAAAACTGGCGAAAG CAGAAGCGAGAACGCTGGGAGAAAATTCAGGCTGACAAGGAGCGGAGGGCCCGGTTACAGGCTGAGGCCC AGGAACGCCTGGGCTACCACGTGGACCCAAGGAGTGCTCGCTTCCAGGAACTATTACAGGACCTAGACAA GCAGCAACGAAAGCGCCTAAAGGAAGAAAGACAACGACAGAAGAAGGAGGCACGAATTGCTGCTATGGCC TCTGCTGAAGCCCAGGACTCAGCAGTGTCTGGTGAACCCAGCTCCTGAAAGCTCCCTTCCCAATAAAGCC AGCTGCTGACAACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: SfiI-SfiI
• ACCN: NM_183358
• Insert Size: 669 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC061069, AAH61069
• RefSeq Size: 745 bp
• RefSeq ORF: 669 bp
• Locus ID: 102060
• UniProt ID: Q9CR59
• Cytogenetics: 8 C3
• Gene Summary: Acts as a negative regulator of G1 to S cell cycle phase progression by inhibiting cyclin-dependent kinases. Inhibitory effects are additive with GADD45 proteins but occurs also in the absence of GADD45 proteins. Acts as a repressor of the orphan nuclear receptor NR4A1 by inhibiting AB domain-mediated transcriptional activity. May be involved in the hormone-mediated regulation of NR4A1 transcriptional activity. May play a role in mitochondrial protein synthesis.[UniProtKB/Swiss-Prot Function]