Eif3j1 (NM_144545) Mouse Untagged Clone

CAT#: MC204885

Eif3j1 (untagged) - Mouse eukaryotic translation initiation factor 3, subunit J (Eif3j), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Eif3j1 (NM_144545) Mouse Untagged Clone
Symbol Eif3j1
Synonyms 1810016I04Rik; 2700079K05Rik; AA409117; AA409446; C78575; eIF-3-alpha-A; eIF-3-alpha-B;
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC080788
TCTTCGCAGCTCTTCCCATCACACACGCTCACCCCCGGTTCGAGATGGCGGCGGCGGCGGCGGCGGCGGC GGCAGCGGCGGCGGGGGACTCAGACTCTTGGGACGCGGACACGTTCTCTATGGAGGACCCGGTGCGGAAG GTCGCGGGCGGCGGCACGGCCGGCGGGGACCGCTGGGAAGGCGAGGACGAGGACGAGGACGTGAAGGATA ACTGGGATGATGATGATGATGAAAATAAAGAGGAAGCAGAAGTCAAACCAGAAGTAAAAATTTCAGAGAA GAAAAAAATAGCAGAAAAGATAAAAGAGAAAGAACGGCAGCAGAAGAAAAGGCAAGAAGAAATTAAAAAG AGGTTAGAAGAACCTGAAGAATCTAAAGTACTAACACCTGAAGAGCAATTAGCAGATAAACTCCGGCTAA AGAAATTACAGGAAGAGTCAGACCTTGAATTAGCAAAAGAAACTTTTGGTGTTAATAATACCGTTTATGG AATAGATGCTATGAACCCATCTTCAAGAGATGACTTCACAGAGTTTGGAAAGTTACTAAAAGATAAAATT ACACAATATGAAAAATCACTATATTATGCCAGTTTTTTGGAAGCCTTAGTTCGGGATGTCTGTATTTCAT TGGAAATTGATGATTTGAAAAAGATTACCAACTCATTGACTGTGCTCTGCAGTGAAAAACAGAAGCAAGA AAAGCAAAGCAAAGCCAAAAAGAAGAAGAAAGGCGTGGTTCCTGGAGGGGGATTAAAGGCCACCATGAAA GACGACCTGGCAGATTATGGTGGATATGAAGGAGGCTATGTACAAGACTATGAAGACTTCATGTGACACT TTACCTTCTGCTGTCTTCTTTCTTTGCCCACAATCCCTTCAACATGTAGCACAACCTCCTTTCCTTTCAG TTCTGCCAAATGCTACAATCAGAAGTGCAGTATCTTTGTGCTGGTTACTTAACCCCTTGACACTCAGGTG CTAATGTGCAAATGAGGGAACTTGGATCTTGTTGCCAAGGGGTTAAAATTGGGAACCTCAGTTGCTACTA AATCATAGTTTAAAAACAAAACAAACCTAATAATGTTGTCATTGTTGCTATCCGATTCCATAGCAGCAGT CACTAAATTGGAAACAAAGGTTGCAACATGACAAAAAAAAAAAGTGTAGTATTTACCAGCACCATTCAGT AATACAGCCTTAACCGTACCTCCTTGAACTACTTCATAACTTGTCGAGAAAAGCAGTTTGCAGCAAGGGC ATGTGGGATGCACCTAGTATTAAAATTGCTTTGTCTTAAAATTGAGGTGAGGATATTAAAAACGTGTGAA GAAGACTGCTTATTTCAGAGTGAAGATAACTGTGGCTGAAAAGTACTAGTTTGATACTTAAGATTTTAAT GACCAAAACCCTCCGACTTGGAAGCTGAAGAAGGTAAACTTCTCCATTATTACAGTGCAAGTGGTGGACT CTCCAGTGCATTGCCTGTCTAGTTATTTATCAGCCTGTTTCTATTGATGGAGGACTTCATATGGGGGAGG GAACTCTGTTTCTGTTTGCCTGATTCAAGTGTCTGAGAAACAAATGTTCTAGGCTGCAGTGGGAAAACTT TGAACAGGGTTTTGGCGTTTCCTTTTCTTTATAAAACGTGCTCAGCAAACTGCACCAGTTACCTACAGTT TGGTAAATTGTTATGTTAACAATTATGACATCTGCAGTGTTTTATAAAGCAACTAATTTAATAAAATCAC TATTGTGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_144545
ORF Size 792 bp
Insert Size 792
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC080788, NP_653128
RefSeq Size 1804
RefSeq ORF 792
Locus ID 78655
Cytogenetics 2|2 E5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.