Twnk (NM_153796) Mouse Untagged Clone

CAT#: MC204875

Peo1 (untagged) - Mouse progressive external ophthalmoplegia 1 (human) (Peo1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Twnk (NM_153796) Mouse Untagged Clone
Symbol Twnk
Synonyms D19Ertd626e; PEO; Peo1; Twinl
Vector pCMV6-Kan/Neo
Sequence Data
>BC071195
GGAGAGTGGTGACGCGAAGCTGGGGGCGGGAGCGTGGAGCTTTGAAGTGGAGGGCAGAGCAAGGGAGCCA GTGAGGAAGCCGGGCCGGAGCGCGTGACCTCCAGCAGTGTGGAGAGTGCCTGTGAGCGCTGGGGGCTCGG AGCGCCTGGAGTTGGGGTTCAGACGGGATGCAGAAAGCGGTAGAGATGAGGTTAGCCAGGAGAGTCCGTA GAGGGGTAGTAGACGTGAAGAGATGATACAGAGAAGCCGTTTAGATCGAGGGACCGTAGAAGGATCTAGA AGTGAGCTGGTGGAGAGAAATCCGTAAAGGACCTAGAGATAGGAGAATCCTCAGAGAGAGGCGTAGACGC GAAAGGGCAGTGTAGGTGTGTAGGGATGAAGTAGCAATACACAGGCAACCGAGGGGAGTAAGAACTGTGT TCGTGAAGAAGTTTGAGGAGGGATAAAGAGAAAAGCCAGTAGGAGTGATTTCTGCGAGTGCCTTGTAGAA GGTTTCCTAGGGTCTGGTTTAGTGAAGGCACTGAACCAGACAACAAAAGCTTTTGCAGTAGTGGCGTCCC ACTCCATTAGGAATGTGGCTTCTTCTCCGACGTGCATATCCCCTCCGGATCTTGCTGCCACTGCGTGGCG AGTGGGTGGGTAGGAGGGGCCTGCCCAGAAGCTTGGCGCCAGGCCCTCCCCGCAGAAGGTACAGAAAAGA AGCGCTCCCAGCCTTAGAGATGCCAGTGTCGCCGGTGACTACGACTGAAATCCGCCAGTATTTACGTGCA CATGGGATCCCCTTCCAGGATGGCCACAGCTGCCTTCGAGCACCAAGTCCCTTTGTGGTGTCCTCAGACA TCAAAAATGAGAAAAAGGACGCTCCCACTTCCTTCTGCCTCTTCATTGACAAGACCACAGGACACTTTCT TTGCATGACCAGCCTAGCAGAAGGGAGCTGGGAAGACTTGCAGGCCAGTGTGGAGGGACGAGGGGATGGG GCCAAAGAGGGTGTCCTACTTAGGGAAGGCCCAGAAGCTGAGGTTAGGGAGGAGGTCTTGAGGATCTGGA ACCGAGCCATACCTCTTTGGGAGCTTCCAGACCCTGAGGAAGCCCAGCTAGCTCGTGTGATGTTTGGCCT TACCAAGGTGACAGATGACACACTCAGGCGATTCAGTGTCCGCTATCTTCGATCTGCTCGAAGTCTGGTC TTCCCTTGGTTCACCCCTGGGAGCTCAGGATTACGTGGCCTGAAGCTACTAGGGGCTGAGGGTCAGGAAA ATGGAGTACAGTATGTAGAGACCACCATCCCCCGGCCTGGTGTCTATCACAACCTATTTGGATTACCACT GATCAGCCGGAGAGATACTGAGGTGGTTGTGACAAGTCGTGAACTGGACAGCCTGGCCTTGAGCCAGTCG ACGGGGCTGCCAACCCTTTCCCTACCCCGAGGGACAGTCTGCTTACCCCCAGCCTTACTGCCTTACCTTG AACAGTTCCGTCGGATTGTGTTCTGGTTAGGAGATGACCTTCGATCCTGGGAAGCTGCCAAACTGTTTGC TCGAAAACTCAACCCCAAGCGATGCTCTCTGGTGAGGCCTGGGAACCAACAGCCTCGTCCCCTGGAGGCC TTAAACCAAGGCTTAAGTCTTCCCCGTATTCTTCGTACCGCCCTACCTGCCTGGCACAAGTCTATTGTGT CTTTTCGGCAGCTCCGAGAGGAGGTTTTAGGAGAACTGTCAAATGTAGAGCAAGCGGCTGGTGTCCGTTG GAGCCGCTTCCCAGACCTGAATCGTCTGCTGAAGGGACATCGGAAGGGCGAGTTGACGGTCTTTACAGGG CCAACAGGCAGTGGCAAGACAACATTCATCAGTGAGTATGCCCTGGACTTGTGTACCCAGGGAGTGAACA CACTGTGGGGTAGCTTTGAGATCAGCAACGTGAGACTAGCCCGGGTCATGCTGACCCAGTTTGCTGTGAC ACGGCTGGAAGAGCAACTGGACAAGTATGAAGAGTGGGCAGACCGTTTTGAGGACCTGCCTCTCTACTTC ATGACTTTCCACGGACAACAGAGCATCAGGTCCGTCATAGACACAATGCAACATGCTGTCTACGTCTATG ACGTCTGTCATGTAGTCATTGACAACTTGCAGTTCATGATGGGTCACGAGCAGCTCTCCTCTGACAGGAT TGCAGCTCAAGACTACATTGTTGGAGCCTTTCGGAAGTTTGCTACAGACAACAGTTGCCACGTGACTCTG GTCATTCACCCTCGGAAAGAAGACGACGACAAGGAACTGCAGACAGCATCCATTTTCGGCTCAGCCAAAG CAAGCCAAGAAGCAGACAATGTTCTGATCTTACAGGATAGGAAACTGGTGACTGGGCCTGGGAAACGGTA TCTGCAGGTGTCCAAGAATCGCTTTGATGGAGACGTAGGTGTCTTCCCACTGGAGTTCAACAAGAATTCC CTTACCTTCTCCATCCCACCCAAGAGCAAAGCCCGACTCAAGAAGATCAAGGACGACAATGGACTAGTGG CCAAAAAATCCTCTTCTGGCAAAAAAGGGGCTGCGCACCAGAACCCTGAGATTTGCTTAGGCCAGGACCC CAGCCCCGCCCAGCCAGATACCTCCAAGTCCTCAGGGTGAAAGCAGTGCACTGCTGCTCGCTGAAATGAG CCTGGTGGAGCAGGCCTTCTGCTGGGGCTCTTCCATATAGTCCTGAGCTACAGAACCCTTCCCAGCCCAG GGCTGGACTCCATGGTGAAAATTTTTAATTGAGCAGCTACTGGGGAATCTCCTGTATGCTGGTTTGTGTT TGTTTTTTCCCCATAGGTTTTCTGTATAGCACTGGAAAGACAAAGGCTGTTTCCAAAGAACCAGCGTTTT GGTGAAAGGAACGAAGCAAAGGGAAGGATGCTAGACTCAGCTCGTTTTGGGTTTTTGTTTTTTGTTTTTC CAGATAGGGTTTCTTCTCTGTATAGCCCTGGCTGTCTTGGAACTCACTTTGTAGACCAGGCTGGCCTCGA ACTCAGAAATCCGCCTGCCTCGTCAGCTTGTTTTGATTAGTCAGTCTGAAAAGGTGTCTGAACAGAGTGC ATGGGAGAACTAGACATGGGCCTGTGAACCTCTGCAGAAAGGGATCCAGATGGAAACACGCCAGACCCTC AGGTGGGAATGAGCAAGGCAGATGAAGAGGCCAGGCCCCTGAAGCTGCCGTGAAACAGGAGGTTTGCTGA AGCTCCAGAGCCGAAGGCTGATGCGGTAGGCACCGAGCCTCTCTGCTCTGCTTTGTAGAGCCAGGCAGAA GAATTGATCTGAGGTGCTGATCCTGTACTCTTAGGGCTTCAAAGATGGAAGCTGCTTCCCACTGGACCAT GGAAAGAAGCTGTAAGCCTGCAGTGCCTGCCCCGTGGGTGCCGATTTCACTGCTGCCTCTGACAGCTGGA GCTAGGACTCTTTTGTAGAGCCTTTTCCAGTTTGAATGAAACATTTCTATTGCCTTTGAAAAAAAAAAAA AAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_153796
ORF Size 2058 bp
Insert Size 2058
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC071195, NP_722491
RefSeq Size 3515
RefSeq ORF 2058
Locus ID 226153
Cytogenetics 19 C3|19 38.19 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.