Stk25 (NM_021537) Mouse Untagged Clone

CAT#: MC204872

Stk25 (untagged) - Mouse serine/threonine kinase 25 (yeast) (Stk25), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Stk25 (NM_021537) Mouse Untagged Clone
Symbol Stk25
Synonyms 1500019J11Rik; AU018434; C86992; Ste20-like; Ysk1
Vector pCMV6-Kan/Neo
Sequence Data
>BC071218
GGGCTGCGGGACTCCTAGTCCCACAGAGCTTCGCGCTCGCCACGACGCCCTGCTCAGAGCCGCTGCCTCC ACCTCACGGGCTGGGAGGCCTGGGCGTTCCGGGAGACCGAATTGCGGTGTGAGCCGCCGTGGGGACTGCG AAGCGGGCCCGGAGTCCGGGATGGAGCCGCCCGGAGGTGCTTGAGGCGAGCGGGCGGAGCGGCTGCGACG GACTGGTCACGTCAGCGGGGACATGGCTCACCTCCGGGGCTTCGCGCACCAGCATTCTCGTGTGGACCCA GAGGAACTCTTCACCAAGCTTGACCGCATTGGCAAAGGCTCATTTGGGGAGGTGTACAAGGGGATCGACA ACCACACCAAGGAAGTGGTGGCCATCAAGATCATTGACTTGGAAGAGGCCGAGGATGAAATTGAGGACAT CCAACAGGAGATCACTGTGCTCAGCCAATGTGACAGTCCTTATATCACCCGCTACTTCGGCTCCTACCTG AAGAGCACCAAGCTGTGGATTATCATGGAGTACCTGGGTGGTGGCTCTGCACTGGACTTGCTGAAACCTG GTCCCCTGGAAGAGACCTATATTGCCACCATCTTGCGGGAGATCCTGAAAGGCCTGGATTATCTGCACTC AGAGCGCAAGATCCACCGAGATATCAAAGCTGCCAACGTGCTGCTCTCGGAGCAGGGTGATGTGAAGCTG GCAGACTTCGGTGTGGCTGGGCAGCTCACAGACACACAAATCAAGAGGAACACATTTGTGGGTACACCCT TCTGGATGGCACCTGAGGTTATCAAGCAGTCGGCCTATGACTTCAAGGCTGACATCTGGTCCCTGGGCAT CACAGCCATTGAGCTGGCCAAGGGGGAGCCGCCAAACTCTGATCTCCACCCTATGCGAGTCCTGTTCCTG ATTCCCAAGAACAACCCACCCACATTGGAGGGCCACCACAGCAAACCCTTCAAGGAGTTTGTAGAGGCCT GCCTCAATAAGGACCCACGATTCCGACCCACTGCCAAGGAGCTCCTGAAGCACAAATTCATCACACGATA CACCAAGAAGACCTCCTTTCTCACTGAACTTATTGACCGATATAAGCGCTGGAAGTCTGAGGGGCATGGA GAGGAGTCCAGTTCTGAGGATTCTGACATTGATGGCGAGGCTGAGGATGGGGAGCAGGGTCCCATCTGGA CGTTTCCTCCAACCATCCGGCCAAGTCCACATAGCAAGCTGCACAAGGGAACTGCTCTGCACAGCTCACA GAAGCCTGCAGAGCCTATCAAGAGACAGCCAAGGTCCCAGTGCTTGTCCACACTAGTCCGTCCTGTCTTT GGAGAGCTCAAAGAGAAGCACAAGCAGAGCGGTGGGAGCGTGGGTGCCCTGGAGGAGCTAGAGAATGCCT TCAGCCTGGCTGAGGAATCCTGTCCTGGCATCTCAGACAAGCTGATGGTGCACCTGGTGGAGCGTGTGCA GAGGTTCTCACACAGCAGGAACCACCTGACATCTACCCGCTGAACAACCAACTGAATGCACTACTCTTCA CAGAGAGGGAGAAGAATGCTGTTTGTTTTGAGCTGTAAAAGGACTGACTTGGAAGCCCTCTTGTGTTGTG TTACAACTGTAAAGACTGACCAGCCTGTAGGCTTCACAAGCCAGGTTACCTTCTTTCTGCCCTACACAGC AGCCCCTTGACACCTGTGTTCACTCCTTGGTTGTCTGAAGCTATGCTAGGCACCTGGGAGCCCTTGCAGA ACTGGGCAGCAACTTGGGAGGCTGGTATGACCTTCTATATAGACTCCTCAGTCCCTGCAGCAGGTAGACC AAGGAGCATAGTAACTATTGGGCAGCTTTGGCTCTTCGTCTACACCAGGGACATTGTCTTGAGGGCTCAT AGGGGCCCAAGATGGTCATAATTTGCCTTGTGGTGTCAGTTCAGGTACTGTGTGTTTTCATGAGTACTCG AATCGTCCAGAATATTTTGGGTTTTTTTTTTTTTTTTTTTAGGAAAATTGAACTTCCTGAGTATTCTGAC ATTAAGTGTTAGTTTTAATAGAGCATTGAAAGCCCTACCATTTCAATAAAGTCCTGGATTGGAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_021537
ORF Size 1281 bp
Insert Size 1281
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC071218, NP_067512
RefSeq Size 2147
RefSeq ORF 1281
Locus ID 59041
Cytogenetics 1 D|1 47.25 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.