Mrps28 (NM_025434) Mouse Untagged Clone
CAT#: MC204671
Mrps28 (untagged) - Mouse mitochondrial ribosomal protein S28 (Mrps28), nuclear gene encoding mitochondrial protein, (10ug)
"NM_025434" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mrps28 |
Synonyms | 1500012D08Rik; AW061224 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028530
GAAGAGGTCAGAGGTCGCGCAGGCGTCATGGCGGCGCTGTGTAGGTCCCACGCCGGGACTGCTGGGAGCC GTTTCTTGAGAGCGCTTGTCTTCTCCAAGCCTTTGCGAAATGCAAGCACGGAGAGTGGTTCCGAGAGCGC AACCCACGACTCCTCCGCTCCTCGGGCGCGTTCAGGCGGCTTCGCGAGCGCTCTGGAGCGACACTTGGAC TTGCAGCGGAAGGCGGAGCTCCGACTGGAGTCTCCAAAACCTGTGGAGTCCTTCGCCTCCATGCTGAGAC ACTCTCCACTGACCCAGCTGGGGCCTGCCAAGGACAAACTGGTCATCGGGCGCATCTTCCATATCGTGGA GGACGATCTCTACATAGATTTTGGTGGCAAGTTTCACTGTGTGTGTAAAAGACCAGATGTGGATGGCGAG AAATACCAGAGGGGCACCAGGGTCCGGCTGCGTCTCCTGGATCTTGAGCTGACATCTAGGTTCCTGGGTG GGACCACAGATACAACTATACTGGAGGCTGATGCAGTTCTCTTAGGACTCCAAGAGATCAGGGACTCAAA ATCAAGAGAGGAGCAACCCAGCAAGTAATGGACTGCGCTTGCTGTATTTGAACCCATTTTGAGCCCAGAA AACTATAAATAAATAAATAATTGAATAAATTTATAATAAATGAAAAGTAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_025434 |
Insert Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC028530, AAH28530 |
RefSeq Size | 781 bp |
RefSeq ORF | 561 bp |
Locus ID | 66230 |
UniProt ID | Q9CY16 |
Cytogenetics | 3 A1 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201746 | Mrps28 (tGFP-tagged) - Mouse mitochondrial ribosomal protein S28 (Mrps28) |
USD 500.00 |
|
MR201746 | Mrps28 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein S28 (Mrps28), nuclear gene encoding mitochondrial protein |
USD 300.00 |
|
MR201746L3 | Lenti ORF clone of Mrps28 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein S28 (Mrps28), nuclear gene encoding mitochondrial protein |
USD 600.00 |
|
MR201746L4 | Lenti ORF clone of Mrps28 (mGFP-tagged) - Mouse mitochondrial ribosomal protein S28 (Mrps28), nuclear gene encoding mitochondrial protein |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review