Serpinb6a (NM_009254) Mouse Untagged Clone

CAT#: MC204591

Serpinb6a (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant 2, (10ug)


  "NM_009254" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Serpinb6a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Serpinb6a
Synonyms 4930482L21Rik; D330015H01Rik; ovalbumin; PI-6; Serpinb6; Spi3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC057950
CTTGCTACCAGTCCGGAAATCGAGAATCTAGGAGAATCTAGGGCTCACCATCATGGATCCTCTACAGGAA GCAAATGGCACCTTTGCCTTAAACCTTTTGAAAATACTGGGTGAAGACAGCTCAAAAAATGTATTTTTGT CACCCATGAGCATATCCTCAGCCCTGGCTATGGTCTTCATGGGGGCAAAAGGAACCACTGCTAGCCAGAT GGCTCAGGCACTTGCTTTGGATAAATGCAGCGGCAATGGAGGTGGAGATGTCCACCAGGGCTTCCAGTCC CTTCTCACCGAAGTGAACAAAACTGGCACACAGTACTTGCTCAGAACAGCCAACAGGCTCTTCGGGGATA AGACTTGTGATCTTTTAGCGTCTTTTAAAGATTCCTGCCTCAAGTTCTATGAAGCAGAGTTGGAAGAGCT GGACTTTCAGGGTGCTACAGAGGAGTCCCGACAGCACATCAACACCTGGGTAGCCAAAAAGACAGAAGAT AAAATCAAAGAGGTGCTGTCTCCAGGTACAGTGAATTCTGATACATCGCTAGTCCTTGTGAATGCCATCT ACTTCAAAGGAAACTGGGAGAAGCAGTTTAACAAAGAGCATACCAGGGAGATGCCATTCAAAGTCAGCAA GAATGAGGAGAAACCTGTGCAAATGATGTTTAAGAAGTCTACCTTTAAGATGACCTATATTGGAGAGATA TTCACTAAGATTCTGTTGCTTCCCTATGTCAGCAGTGAGCTGAACATGATCATCATGCTTCCAGATGAGC ACGTTGAACTGAGTACAGTGGAAAAGGAAGTAACTTACGAGAAATTTATAGAGTGGACAAGGCTGGACAA GATGGACGAAGAAGAGGTAGAAGTATTTCTCCCAAAGTTTAAGCTGGAGGAGAATTACAACATGAACGAT GCCCTCTACAAGTTGGGCATGACTGATGCCTTTGGCGGCAGGGCAGACTTTTCTGGAATGTCTTCCAAGC AAGGCTTGTTTCTGTCTAAGGTTGTGCATAAGGCCTTTGTGGAGGTTAATGAGGAGGGCACAGAGGCTGC AGCTGCTACAGCTGGCATGATGACGGTGAGGTGCATGAGATTCACTCCCCGCTTCTGTGCCGACCACCCC TTCCTTTTCTTCATTCACCATGTTAAGACCAATGGAATTCTGTTCTGTGGCCGGTTCTCCTCTCCCTGAG CAAAGGGTATTCCTGTCAGTCTTTGACCCTCTCTCCATGGTTTGCTGTAACCCAAGTGACCTTATCCATA AGTGCAATGGCAATTATGAAATAAAGGGCTTTATGGCACCCCACCTTCAGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009254
Insert Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC057950, AAH57950
RefSeq Size 1325 bp
RefSeq ORF 1137 bp
Locus ID 20719
UniProt ID Q60854
Cytogenetics 13 14.0 cM
Gene Summary Inhibitor of cathepsin G, kallikrein-8 and thrombin. May play an important role in the inner ear in the protection against leakage of lysosomal content during stress. May be involved in the regulation of serine proteinases present in the brain or extravasated from the blood.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and uses a downstream, in-frame start site, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.