Serpinb6a (NM_009254) Mouse Untagged Clone
CAT#: MC204591
Serpinb6a (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant 2, (10ug)
"NM_009254" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Serpinb6a |
Synonyms | 4930482L21Rik; D330015H01Rik; ovalbumin; PI-6; Serpinb6; Spi3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC057950
CTTGCTACCAGTCCGGAAATCGAGAATCTAGGAGAATCTAGGGCTCACCATCATGGATCCTCTACAGGAA GCAAATGGCACCTTTGCCTTAAACCTTTTGAAAATACTGGGTGAAGACAGCTCAAAAAATGTATTTTTGT CACCCATGAGCATATCCTCAGCCCTGGCTATGGTCTTCATGGGGGCAAAAGGAACCACTGCTAGCCAGAT GGCTCAGGCACTTGCTTTGGATAAATGCAGCGGCAATGGAGGTGGAGATGTCCACCAGGGCTTCCAGTCC CTTCTCACCGAAGTGAACAAAACTGGCACACAGTACTTGCTCAGAACAGCCAACAGGCTCTTCGGGGATA AGACTTGTGATCTTTTAGCGTCTTTTAAAGATTCCTGCCTCAAGTTCTATGAAGCAGAGTTGGAAGAGCT GGACTTTCAGGGTGCTACAGAGGAGTCCCGACAGCACATCAACACCTGGGTAGCCAAAAAGACAGAAGAT AAAATCAAAGAGGTGCTGTCTCCAGGTACAGTGAATTCTGATACATCGCTAGTCCTTGTGAATGCCATCT ACTTCAAAGGAAACTGGGAGAAGCAGTTTAACAAAGAGCATACCAGGGAGATGCCATTCAAAGTCAGCAA GAATGAGGAGAAACCTGTGCAAATGATGTTTAAGAAGTCTACCTTTAAGATGACCTATATTGGAGAGATA TTCACTAAGATTCTGTTGCTTCCCTATGTCAGCAGTGAGCTGAACATGATCATCATGCTTCCAGATGAGC ACGTTGAACTGAGTACAGTGGAAAAGGAAGTAACTTACGAGAAATTTATAGAGTGGACAAGGCTGGACAA GATGGACGAAGAAGAGGTAGAAGTATTTCTCCCAAAGTTTAAGCTGGAGGAGAATTACAACATGAACGAT GCCCTCTACAAGTTGGGCATGACTGATGCCTTTGGCGGCAGGGCAGACTTTTCTGGAATGTCTTCCAAGC AAGGCTTGTTTCTGTCTAAGGTTGTGCATAAGGCCTTTGTGGAGGTTAATGAGGAGGGCACAGAGGCTGC AGCTGCTACAGCTGGCATGATGACGGTGAGGTGCATGAGATTCACTCCCCGCTTCTGTGCCGACCACCCC TTCCTTTTCTTCATTCACCATGTTAAGACCAATGGAATTCTGTTCTGTGGCCGGTTCTCCTCTCCCTGAG CAAAGGGTATTCCTGTCAGTCTTTGACCCTCTCTCCATGGTTTGCTGTAACCCAAGTGACCTTATCCATA AGTGCAATGGCAATTATGAAATAAAGGGCTTTATGGCACCCCACCTTCAGAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009254 |
Insert Size | 1137 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC057950, AAH57950 |
RefSeq Size | 1325 bp |
RefSeq ORF | 1137 bp |
Locus ID | 20719 |
UniProt ID | Q60854 |
Cytogenetics | 13 14.0 cM |
Gene Summary | Inhibitor of cathepsin G, kallikrein-8 and thrombin. May play an important role in the inner ear in the protection against leakage of lysosomal content during stress. May be involved in the regulation of serine proteinases present in the brain or extravasated from the blood.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and uses a downstream, in-frame start site, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227126 | Serpinb6a (tGFP-tagged) - Mouse serine (or cysteine) peptidase inhibitor clade B member 6a (Serpinb6a) transcript variant 2, (10ug) |
USD 657.00 |
|
MR227126 | Serpinb6a (Myc-DDK-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant 2 |
USD 457.00 |
|
MR227126L3 | Lenti ORF clone of Serpinb6a (Myc-DDK-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant 2 |
USD 757.00 |
|
MR227126L4 | Lenti ORF clone of Serpinb6a (mGFP-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a (Serpinb6a), transcript variant 2 |
USD 757.00 |
{0} Product Review(s)
Be the first one to submit a review