Dtnbp1 (NM_025772) Mouse Untagged Clone

CAT#: MC204576

Dtnbp1 (untagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1), (10ug)


  "NM_025772" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dtnbp1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dtnbp1
Synonyms 5430437B18Rik; AW048963; Bloc1s8; dysbindin; sdy
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC018350
GCCGGGGAGGCTGCGGCGGCGGCGGCGCGGTGAAGCGAGAGCCGACGCGCGGGGCGAGGGGACGCCCGAC GGCGTCCGAGGGCGCGGTGGCGCGAGGCCTGAGGGAGGGGACGCGATGCTGGAGACCCTGCGCGAGCGGC TGCTGAGCGTACAGCAGGATTTCACCTCCGGGCTGAAGACTTTAAGTGATAAGTCAAGAGAAGCAAAAGT GAAAGGCAAACCCAGGACTGCTCCACGCTTACCGAAGTACTCTGCTGGACTAGAATTACTTAGCAGGTAT GAGGATGCGTGGGCTGCACTTCACAGAAGAGCCAAGGAGTGTGCAGACGCTGGCGAGCTGGTGGACAGCG AGGTGGTCATGCTGTCTGCCCACTGGGAGAAGAAGAGGACCAGCCTGAACGAGCTGCAGGGGCAGCTGCA GCAGCTGCCCGCTCTCCTGCAGGACTTGGAGTCTCTGATGGCAAGCCTGGCTCATTTAGAGACAAGTTTT GAAGAGGTAGAGAACCATTTGCTGCACCTGGAGGACTTGTGTGGGCAGTGTGAGTTAGAAAGACACAAGC AGGCCCAGGCCCAACACCTGGAGAGCTACAAGAAAAGTAAGAGGAAGGAGCTTGAAGCCTTCAAAGCTGA ACTCGATACAGAGCACACACAGAAGGCCCTGGAAATGGAGCACACCCAGCAACTGAAGCTGAAGGAGCGG CAGAAGTTCTTCGAGGAAGCCTTCCAGCAGGACATGGAACAGTACCTGTCCACGGGCTACCTGCAGATCG CAGAGAGGCGAGAGCCTATGGGCAGCATGTCATCCATGGAAGTGAATGTGGACGTGCTGGAGCAGATGGA CCTGATGGACATCTCAGACCAGGAGGCTCTCGATGTCTTCCTGAACTCCGGCGGAGAGGACAACATTGTG ATGTCCCCTGGTGTGGAGATGGAATCCAACCCCAATCAGAATGAAATGAGTCTTCAGATTCCAAGTCCCT CAGAATCAGCATCCCAGCCACCTGCCTCACCCTCTGCCTGCACTGACCTGGACACTGCTGATGCCCCCCT CATCCAGTCTGATGAGGAGGAGGTACAGGTGGACACGGCCTTGGTCACATTACACACTGACAGAAAGTCC ACCCCAGGTGTCAGTGATGACAGTGACCAGTGTGACTCAACTCAGGACATTTAAGTGACTTGTCAGCTGT GCGCAGAATCCTCCTGCAAAGCCAGGTGCTTAGAGGTTTTCAATTTTACACACTTGCTAATGGGATGTAA GAACCATTAGAGAAGCGCTCACAATAAAGCTTATGGAATAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025772
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC018350, AAH18350
RefSeq Size 1314 bp
RefSeq ORF 1059 bp
Locus ID 94245
UniProt ID Q91WZ8
Cytogenetics 13 21.73 cM
Gene Summary Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes. In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals. The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension. Associates with the BLOC-2 complex to facilitate the transport of TYRP1 independent of AP-3 function. Plays a role in synaptic vesicle trafficking and in neurotransmitter release. Plays a role in the regulation of cell surface exposure of DRD2. May play a role in actin cytoskeleton reorganization and neurite outgrowth. May modulate MAPK8 phosphorylation. Appears to promote neuronal transmission and viability through regulating the expression of SNAP25 and SYN1, modulating PI3-kinase-Akt signaling and influencing glutamatergic release. Regulates the expression of SYN1 through binding to its promoter. Modulates prefrontal cortical activity via the dopamine/D2 pathway.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.