Fxyd1 (NM_052992) Mouse Untagged Clone
CAT#: MC204574
Fxyd1 (untagged) - Mouse FXYD domain-containing ion transport regulator 1 (Fxyd1), transcript variant 3, (10ug)
"NM_052992" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd1 |
Synonyms | 0610012C17Rik; 1110006M24Rik; P; Plm; Pml |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024671
GGAGAGCTGGGACGGCCTGGGTACAGAGAGACCACTGGTTGAGGGCAATGGCATCTCCCGGCCACATCCT GGCTCTGTGTGTGTGTCTCCTCTCCATGGCCAGTGCAGAAGCTCCACAGGAACCGGATCCATTCACCTAC GATTACCACACCCTGCGGATCGGCGGCCTCACTATCGCTGGGATCCTCTTCATCTTGGGCATCCTTATCA TCCTTAGCAAGAGATGTCGATGCAAATTCAACCAACAGCAGAGAACTGGGGAACCCGACGAAGAGGAGGG AACTTTCCGCAGCTCCATCCGCCGTCTGTCATCCCGCAGGCGGTAGAACCTCCACCTGACTCCAGGAAAC TCAGCCAGAGCCCCCTTAGCACCTGACACCTCTCCCCACCCAGATGCTCGCCTGTGACCACCCCCAGCGT TCCCTGCATCAGCCCTGCCTTTCGGACACCCCTTGCTGCTCAGACCTCTAATAAAACTCGGTTTTCCTTC TTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_052992 |
Insert Size | 279 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024671, AAH24671 |
RefSeq Size | 507 bp |
RefSeq ORF | 279 bp |
Locus ID | 56188 |
UniProt ID | Q9Z239 |
Cytogenetics | 7 B1 |
Gene Summary | This gene encodes a member of the FXYD family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity and act as an accessory protein of Na,K-ATPase. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Variants 3, 4 and 5 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200238 | Fxyd1 (tGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 1 (Fxyd1), transcript variant 3 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review