(XM_980237) Mouse Untagged Clone

CAT#: MC204553

(untagged) - PREDICTED: Mouse stromal interaction molecule 1, transcript variant 5 (Stim1), (10ug)

USD 176.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name (XM_980237) Mouse Untagged Clone
Vector pCMV6-Kan/Neo
Sequence Data
>BC021644
CCACGCGTCCGGGCCCGTGCGCGTCCGCCTGCTGCACCGGGGCACCAGGAGCCGCAGAGGTACCGGACCC GGCGGGGGCGCTGACCTCGGCCTAGGAGTCTTAGGATCCCGGAGACATCCGTGTCTGCTGGGGCCTGTAG GTCGCACGCCGAAGCCCTAGCTGCTGAGGCTCACCGCTGTTTCGCGGGGCGAGGTCAGGTGCCCCCCTTC TCTCCTCTCTTCTCTCCCTCCCCCACCTCAGTGCGGGCGGGAGATTCTGCCCGCCTCCTCCCGCAGGGGT GCAGCAGGCTGCGGAGCTGACAGCGGCCCCGCAGCCACCCTGCTCAAACTCTCCGGAAGCAGATAGAGCT CAGGCCGCCGCCGCAGCCCCGGCGGACCTACAGTTGGACCGGAGACTCCGATCCTTCTGCGTCCAAACTT GGGGCACTTGACCTTCGCTTATCGGAGGAGGTAAGCCCGCAGGTGGCTGGACAGCTGCGGCGCCGCGAGG GCATCTTGCTTTGGAACCGTCGGCTGCACTCCCTGACTCTGGGATTTGCTTCTGGGATCCAAAGGTGTCT ACAGCAGGCGCATGTTGACTGAGACCTACCGTCATGGATGTGTGCGCCCGTCTTGCCCTGTGGCTTCTTT GGGGGCTCCTTCTGCATCAGGGCCAGAGTCTCAGCCATAGTCACAGTGAAAAGAATACAGGAGCTAGCTC CGGGGCGACTTCTGAAGAGTCTACCGAAGCAGAGTTTTGCCGAATTGACAAGCCCCTGTGCCACAGTGAG GATGAGAAGCTCAGCTTTGAGGCCGTCCGAAACATCCATAAGCTGATGGATGACGATGCCAATGGTGATG TGGATGTGGAAGAAAGTGATGAGTTCCTAAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACATAG CACCTTCCATGGTGAGGATAAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAATCATCAGAAGTG TACAACTGGACTGTGGATGAGGTGATACAGTGGCTCATTACGTATGTGGAGCTGCCACAGTATGAGGAGA CCTTCCGGAAGTTGCAGCTTACTGGCCACGCCATGCCAAGGCTAGCAGTAACCAACACCACCATGACAGG GACTGTACTGAAGATGACAGATCGGAGCCACAGGCAGAAGCTGCAGCTGAAGGCCCTGGACACAGTGCTG TTTGGGCCTCCTCTCTTGACTCGGCATAATCACCTGAAGGACTTCATGCTGGTGGTGTCTATCGTTATTG GTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAA GGATCTGGAAGGGTTACACCGGGCTGAGCAGAGTCTGCATGACCTTCAGGAAAGGCTGCACAAGGCCCAG GAGGAGCACCGAACTGTGGAAGTAGAGAAAGTCCACCTGGAGAAGAAGCTGCGAGATGAGATCAACCTTG CCAAGCAGGAAGCTCAGCGGCTGAAGGAGCTGAGGGAGGGTACTGAGAATGAGAGGAGCCGTCAAAAATA TGCTGAGGAAGAGCTGGAGCAGGTTCGGGAGGCCTTGAGGAAAGCAGAGAAGGAGCTGGAATCACACAGC TCATGGTATGCTCCTGAGGCCCTGCAGAAGTGGCTGCAGCTGACCCATGAGGTGGAGGTGCAGTACTACA ACATCAAGAAGCAAAATGCAGAGAGGCAGCTGCTGGTGGCCAAGGAGGGGGCTGAGAAAATAAAAAAGAA GAGAAACACGCTTTTTGGTACCTTCCATGTGGCCCACAGCTCTTCCCTGGATGATGTGGATCATAAAATC CTAACTGCTAAGCAAGCTCTGAGTGAGGTGACAGCGGCACTGAGGGAGCGCCTGCACCGGTGGCAGCAGA TCGAGATCCTCTGCGGTTTCCAGATTGTCAATAACCCCGGCATCCACTCCTTGGTGGCTGCTCTCAACAT CGACCCCAGCTGGATGGGCAGCACCCGCCCTAACCCCGCCCACTTCATCATGACTGACGATGTGGATGAC ATGGATGAGGAGATTGTGTCGCCCTTGTCCATGCAGTCCCCCAGCCTGCAGAGCAGTGTCCGGCAGCGCC TGACGGAGCCACAGCTTGGCCTGGGATCTCAGAGGGATTTGACCCATTCCGATTCGGAGTCCTCCCTCCA CATGAGTGACCGCCAGCGTGTGGCCCCCAAGCCTCCTCAGATGGGCCGTGCTGCAGATGAAGCTCTCAAT GCCATGCCTTCCAATGGCAGCCATCGGCTGATTGAGGGGGTCCATCCAGGATCTCTGGTGGAGAAACTGC CTGACAGCCCTGCTCTGGCCAAGAAGACATTTATGGCGTTGAACCATGGCCTAGACAAGGCCCACAGCCT GATGGAGCTGAACCCCTCAGTCCCACCTGGTGGCTCCCCACTTTTGGATTCTTCCCATTCTCTTAGCCCC AGTTCCCCAGACCCAGACACACCATCTCCAGTTGGGGACAACCGAGCTCTGCAGGGTAGCCGAAACACAC GAATTCCCCACTTGGCTGGCAAGAAGGCAATGGCTGAGGAGGATAATGGTTCCATTGGTGAGGAGACAGA CTCCAGTCCAGGCAGGAAGAAGTTTCCTCTCAAAATTTTTAAGAAGCCTCTTAAGAAGTAGGCAGACTAG GGTGGTAGTGTTGAGACAGCCTGTCCTTCCCTGGGTCTTCTGCCTTCACCTCCCTTCCTTTCTTTGCAAT ATCTGGCTCCTAGAGTGGGGCACAGAGGGGCTGGCCCAAGGGCCTGGGCACTGTACATATCTGCCCTGCT CATCCTTGGTCCTTCATCATTATTTATTAACTGACCACCATGGCCTGCCTGTCGGGAAACCCTTCCACCC ATGGGCTGCTGCTGTCACATCTTCTCCACTTCAGTGCATGTCTTAGTTGCTCTTCCCTCAGTTCCCACTC CACTTTTGGGGTCCAGCTTCTGTCTCTGCTGTCCCAGTTTTGAGGTTTGGTTTTTGTTTCTGTCTCCTGC TTTCAGGCTCCTCTCTCCCATTACTCCCCAACGATCCTAGCAGTTGTGGGGAAGATAGGAGGAGTAACTT CTGACACCTGTACCTCAGATCTGTTCATCCTACTCACAGCCATTCTGCCTACCCCAGACTGGGCCACGGT CCTGATCTCTGGGGTTTGTTCTATGGAAGTGTGGTAGACTGGAGGGAACCTCATCCTGGAGCTCCTTTGG ATCTCCAGGGCTCCATTCAGGGAGTGGAACCAACTCCCAGGGAACAAGTCACCAGAGTTTTAAAGAGAGA CCAGGCTTGTGATTGATGGGAGAGACTTCTCCCAGTTGGAGGATGAGTAGATGCCAAAGCTGTGGGCTGT AAGGCAGTTGCCATTTCTCTCTTGCCCTGCCCACACCTGCCTTCCTCTTACCTCTGCTCCCCTATATTGC AGGAGTGTATCTCTTAAGAGGTGCTGCCCTGAAGCTCCCCATCAGCATCAGCACTACTGGGGCTCAGGGC AACTGGCTCCCCTGGCTATGGGAGCCACAGTCATGACACAGGGCTCTTGTGGAGCCCTGGGCAAGGATGT TATATTTGAACCAAAAGACAAACAGTTTTAAAATAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN XM_980237
ORF Size 2058 bp
Insert Size 2058
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 3619
RefSeq ORF 2058
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
48 Mouse Clones