Vkorc1 (NM_178600) Mouse Untagged Clone
CAT#: MC204511
Vkorc1 (untagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1), (10ug)
"NM_178600" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Vkorc1 |
Synonyms | D7Wsu86; D7Wsu86e |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC031732
CTGGGCTGTACTGTCGACATGGGCACCACCTGGAGGAGCCCTGGACTGGTGCGGCTTGCACTGTGCCTCG CTGGCTTAGCCCTCTCACTGTACGCACTGCACGTGAAGGCGGCGCGCGCCCGCGATGAGAATTACCGCGC GCTCTGCGATGTGGGCACGGCCATCAGCTGTTCCCGCGTCTTCTCCTCTCGGTGGGGCCGGGGCTTTGGG CTGGTGGAGCACATGCTAGGAGCGGACAGCGTCCTCAACCAATCCAACAGCATATTTGGTTGCCTGTTCT ACACCTTACAGCTGTTGTTAGGTTGCTTGAGGGGACGTTGGGCCTCTATCCTACTGGTGCTGAGTTCCCT GGTGTCCGTCGCTGGTTCCGTGTACCTGGCCTGGATCCTGTTCTTTGTGTTATATGATTTCTGTATTGTG TGCATTACCACCTATGCCATCAATGTGGGTCTGATGTTGCTTAGCTTCCAGAAGGTACCAGAACACAAGA CCAAAAAGCACTGAGTTCCCACCTCATGCCAGACTAACCTAACTTGCTTTGCCTTGGCACATGACCCTTG CCCAAGTGTGTGGGTTCCTAGAAGGCCCTACCCACCTCATTCAAACCCCCTCCATAACCACACACAGAGA AATGACCAAACGTGCCTCTAAGTTCTGTTCCCATGGGCTGCATTCTGCTGTTGGTTAAAGAGAAGGATTT TGAACAATAAATTTTTCTATGTTGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_178600 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC031732, AAH31732 |
RefSeq Size | 769 bp |
RefSeq ORF | 486 bp |
Locus ID | 27973 |
UniProt ID | Q9CRC0 |
Cytogenetics | 7 69.81 cM |
Gene Summary | Vitamin K is essential for blood clotting but must be enzymatically activated. This enzymatically activated form of vitamin K is a reduced form required for the carboxylation of glutamic acid residues in some blood-clotting proteins. The product of this gene encodes the enzyme that is responsible for reducing vitamin K 2,3-epoxide to the enzymatically activated form. Fatal bleeding can be caused by vitamin K deficiency and by the vitamin K antagonist warfarin, and it is the product of this gene that is sensitive to warfarin. In humans, mutations in this gene can be associated with deficiencies in vitamin-K-dependent clotting factors and, in humans and rats, with warfarin resistance. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201263 | Vkorc1 (tGFP-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1) |
USD 350.00 |
|
MR201263 | Vkorc1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1) |
USD 150.00 |
|
MR201263L3 | Lenti ORF clone of Vkorc1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1) |
USD 450.00 |
|
MR201263L4 | Lenti ORF clone of Vkorc1 (mGFP-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review