Tpmt (NM_016785) Mouse Untagged Clone

CAT#: MC204307

Tpmt (untagged) - Mouse thiopurine methyltransferase (Tpmt), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tpmt (NM_016785) Mouse Untagged Clone
Symbol Tpmt
Synonyms AW106912
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC021598
GGCACTGGAGACACCAACCTCAGAGACAAAAATTGTCTACAACCCGTGGATGGTACCATGTCCCTTGATA TGAAAGAGCACCCTGATGCTGAGGTACAAAAGAACCAAGTACTAACCCTGGAAGACTGGAAAGAGAAGTG GGTGACCCGTCACATCTCATTCCATCAGGAGCAAGGGCATCAGCTATTAAAGAAGCATTTGGATACATTT CTTAAAGGCCAGAGTGGACTGCGAGTGTTTTTCCCCCTCTGTGGAAAAGCCATTGAGATGAAATGGTTCG CAGATCGGGGCCACACTGTAGTTGGTGTGGAAATCAGTGAAATTGGGATTCGGGAATTTTTTGCAGAACA GAATCTTTCCTACACAGAAGAACCGCTCGCCGAAATTGCTGGAGCCAAAGTATTTAAGAGTTCTTCAGGG AGCATTTCCTTATACTGCTGCAGCATATTTGATCTTCCTAGAGCAAACATTGGCAAGTTTGACAGGATTT GGGATAGAGGAGCATTAGTGGCTATCAATCCAGGCGATCATGATCGCTATGCAGATATAATACTGTCCCT ACTGAGAAAAGAGTTTCAGTACCTCGTGGCTGTCCTTTCTTATGATCCAACAAAACACGCAGGCCCACCA TTTTATGTTCCATCTGCTGAACTTAAAAGGTTATTTGGTACAAAATGCAGCATGCAATGCCTTGAAGAGG TAGACGCTTTGGAAGAAAGGCATAAAGCCTGGGGTCTTGACTACCTTTTTGAAAAATTGTATCTCCTTAC AGAGAAGTAAAACCAGCCTGGTAGTGGAGCACACCTTTTATCTCAGCAGGCTAGCCTGGTCTACCAGTGA GTTCCAAGACAGCCAGAGAGACCCTATCTGGAAAAACCAAATAGAAAACCAACCAAACAAACAAAAAACA CCCAATCAATCCCTGTATGAGTTTTTTGAACAATTAAAAATTATGTTGAGGGTTAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_016785
ORF Size 723 bp
Insert Size 723
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC021598, NP_058065
RefSeq Size 1006
RefSeq ORF 723
Locus ID 22017
Cytogenetics 13 A5|13 24.5 cM
Gene Summary Catalyzes the S-methylation of thiopurine drugs such as 6-mercaptopurine. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.