Lsm10 (NM_138721) Mouse Untagged Clone
CAT#: MC204183
Lsm10 (untagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10), transcript variant 1, (10ug)
"NM_138721" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Lsm10 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024543
CGTCCTCTTCCCCTGGCGCACTGGCTGCGGACTTTTCTTCCCAAACCCCTTACGCGCGTGAGCAGCCAGC CAATGTGGAACAATGGCACTGAGCCACTCGGTGAAGGAGCGAACTATTTCTGAGAACAGCCTGATCATCC TGTTGCAGGGCCTCCAAGGCCAAATAACCACTGTGGACCTTCGGGATGAGAGTGTGGCCCGAGGACGCAT TGACAACGTGGATGCTTTCATGAATATCCGCCTGGCCAATGTCACCTATACCGACCGCTGGGGACATCAG GTTGAGTTGGATGACCTTTTTGTGACCGGTCGTAACGTCCGATACGTCCATATCCCAGATGGTGTGGACA TCACTGCTACTATTGAGCAGCAGCTGCAGATCATCCACCGTGTGCGCAACTTTGGTGGCAAGGGTCAAGG TCGTCGAGAGTTCCCCTCCAAAAGGCCATGAGACTGTGCCCTCGTTAAAGTTCCAGCACCACCTCAGGGA CCTCCGGTGTTCTGAGCCAACTCCCGGCCATCCTTCCCCACCAGTAACAGACATGTCACAGCGGCCTTTC GTAGGGTTCCAGTTTTCAGACACACCCTGGGACCCAGAATTCCTTCTGCTGGTGGCCTTGGGGTAGGTGA CAATCCCTCTTTTGGATCATTTGTATCTCGAATCTCCATTCACTGATTGGACCCCGTCCATCAAGGAGTC GTCAACTCTGGCTGTGAGGAGTACTGCGAGTGTTTGGAGTGAATCACCTCTAACGTCCCGTTTCTTTTTG GCATTTGTTTCTTTTCTCATAAAACCAAACTTGGATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_138721 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024543, AAH24543 |
RefSeq Size | 869 bp |
RefSeq ORF | 369 bp |
Locus ID | 116748 |
UniProt ID | Q8QZX5 |
Cytogenetics | 4 D2.2 |
Gene Summary | Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing (By similarity). Increases U7 snRNA levels but not histone 3'-end pre-mRNA processing activity, when overexpressed (By similarity). Required for cell cycle progression from G1 to S phases (By similarity). Binds specifically to U7 snRNA (By similarity). Binds specifically to U7 snRNA (By similarity). Binds to the downstream cleavage product (DCP) of histone pre-mRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC207206 | Lsm10 (untagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10), transcript variant 1, (10ug) |
USD 165.00 |
|
MG200601 | Lsm10 (tGFP-tagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10) |
USD 350.00 |
|
MG216351 | Lsm10 (tGFP-tagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10) transcript variant 1, (10ug) |
USD 350.00 |
|
MR216351 | Lsm10 (Myc-DDK-tagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10), transcript variant 1 |
USD 150.00 |
|
MR216351L3 | Lenti ORF clone of Lsm10 (Myc-DDK-tagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10), transcript variant 1 |
USD 450.00 |
|
MR216351L4 | Lenti ORF clone of Lsm10 (mGFP-tagged) - Mouse U7 snRNP-specific Sm-like protein LSM10 (Lsm10), transcript variant 1 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review