Cox6b1 (NM_025628) Mouse Untagged Clone

CAT#: MC204181

Reviews ()
Write a review

Cox6b1 (untagged) - Mouse cytochrome c oxidase, subunit VIb polypeptide 1 (Cox6b1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_025628" in other vectors (4)

USD 242.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox6b1
Synonyms 2010000G05Rik; Cox6b
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024343
CTAAGGGTCACATTGAAGTAACGCTACTCCGGGACAATCTTTAGGAGTCAGGATGGCTGAAGACATCAAG ACTAAAATCAAGAACTACAAAACTGCCCCCTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAAGAACT GTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACGGCCAAGGGGGGTGATGTCTCCGT GTGTGAGTGGTACCGGCGTGTGTACAAGTCCCTCTGTCCCGTGTCATGGGTCTCAGCCTGGGATGACCGC ATAGCTGAAGGCACATTTCCTGGGAAGATCTGACCTGGCTCCGCCCACCTCTCCTCTGTTCTTTGTCTTT CTCCCCGGATAGAAAAGGGGGACCTCAGCATATGATGGTCCTTACCCTGGGACCCTGAATCATGATGCAA CTACTAATAAAAACTCACTGGAAAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025628
Insert Size 261 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024343, AAH24343
RefSeq Size 501 bp
RefSeq ORF 261 bp
Locus ID 110323
UniProt ID P56391
Cytogenetics 7 18.84 cM
Gene Summary Connects the two COX monomers into the physiological dimeric form.[UniProtKB/Swiss-Prot Function]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.