1110006G06Rik (NM_028661) Mouse Untagged Clone

CAT#: MC204118

1110006G06Rik (untagged) - Mouse RIKEN cDNA 1110006G06 gene (1110006G06Rik), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 1110006G06Rik (NM_028661) Mouse Untagged Clone
Symbol 1110006G06Rik
Synonyms AI836081; AV026483; B230110F21Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC023421
CGGACGCGTGGGCGGACGCGTGGGCGGCTCCAGCGGGATTCTAGCCCTGTGCCATCCTTTGGAGAAGGGA CAAAGAAGGCGAATGGCGTTGTTCAGGAACTGACGCTAACTCTTCAAGCCCTGGGGCTCCCCAGACCCCT GCGTGGAACCCTGGCTAGCCAGCTACTTCGGGAGTTTCATGACAAGATCTCTGAGCTGCTGCCGTCCCTG CCCCCGGAGTCCATGAAGCCCCTCCTTAACTCGCAGCTGGATGCATCCCGATGGGAAGCCCTGGAGTCTC TGTCCCAAAGCCTGACAGAGCAGTACTGCTGCCGCCGCTGCCTCCTCCTGAAGCGCCTTGACCTCACAAC ATCTGCTTTCCACTGGGGTGACCGGGCAGAGGCCCACGGAGAGGTCATGAAGGCGGTGCTGTTCCCAATC CGAGGGCTTCTGACTCCAGAATCTGATGTCTCTATCGCACATGTTCTGGCTGCCCGAGCTGACCTTTCCC GCCTGGTCCCAGCTACCAGTGTGGCTGCCCGACGAGGGACCAGTTGTGCAATCAACAAGGTGCTTATGGG TGATGTGCCAGACCGTGGGGGGCGCCCCAGTGAGCTGGAGGCTCCCATGCCTACTTGGAAGAGCCGACGA GAAGATGGAGGAAGGGGGAAGGCTGGCCAACAGCGCTGGGGCCGCAGAAAGAAGAAGAAGTGAAGGGCCT TTGAGGAACGGTTGCAGATTCTGCCAGGTGCTGATGCTGCTGGCAGTCCTTCAGGAGGCACTGAGGGGTT ATCCTCGGCAAGCCTGGCCTTCCCTATTCTAGAGGCCCTAAATGCCCTACACCCAGCCGCCACTCAACAC TATGAACCGTGTTGTCTGAAAAATAAATTTAGTTCTTTTGATGGCAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_028661
ORF Size 357 bp
Insert Size 357
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC023421, NP_082937
RefSeq Size 925
RefSeq ORF 357
Locus ID 73833
Cytogenetics 7|7 B1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

"1110006G06Rik" in other Product Lines