Klk1b9 (NM_010116) Mouse Untagged Clone
CAT#: MC204066
Klk1b9 (untagged) - Mouse kallikrein 1-related peptidase b9 (Klk1b9), (10ug)
"NM_010116" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Klk1b9 |
Synonyms | EGF-BP C; Egfbp; Egfbp-; Egfbp-3; Egfbp3; KAL; kallikrein; Klk; Klk9; mGk-9 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024624
TGGACACCTGTTACCATGAGGTTCCTGATCCTGTTCCTAGCCCTGTCCCTAGGAGGGATTGATGCTGCAC CTCCTGTCCACTCTCGAATTGTTGGAGGATTTAAATGTGAGAAGAATTCCCAACCCTGGCATGTGGCTGT GTACCGTTACAACGAATATATATGCGGGGGTGTCCTGTTGGATGCCAACTGGGTTCTCACAGCTGCCCAC TGCTATTACGAAGAGAACAAGGTTTCCCTAGGAAAAAACAACCTATACGAAGAGGAACCCTCTGCTCAGC ACCGATTGGTCAGCAAAAGCTTCCTTCACCCTGGCTACAACAGGAGCCTCCATAGAAACCACATCCGACA TCCTGAGTATGACTACAGCAATGACCTGATGCTGCTCCGCCTCAGCAAGCCTGCTGACATCACAGATGTT GTGAAGCCCATCGCCCTGCCTACTGAGGAGCCCAAGCTGGGGAGCACATGCCTTGCCTCAGGCTGGGGCA GCACTACACCTTTCAAGTTCCAAAATGCAAAAGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGA GGACTGTGGCAAAGCCCACATAGAGAAGGTGACAGATGTCATGCTGTGTGCAGGAGAGACAGATGGAGGC AAAGACACTTGCAAGGGAGACTCAGGAGGCCCACTGATCTGTGATGGTGTTCTCCAAGGTATCACATCAT GGGGCTTTACCCCATGTGGTGAACCCAAAAAGCCGGGCGTCTACACCAAACTTATTAAGTTTACCTCCTG GATCAAAGACACTATGGCAAAAAACCTCTGAGTGATACACTGTCTGCCTTTCTCAATAAAATTCACTATG CAACAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010116 |
Insert Size | 786 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024624, AAH24624 |
RefSeq Size | 859 bp |
RefSeq ORF | 786 bp |
Locus ID | 13648 |
UniProt ID | P15949 |
Cytogenetics | 7 28.45 cM |
Gene Summary | This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203393 | Klk1b9 (tGFP-tagged) - Mouse kallikrein 1-related peptidase b9 (Klk1b9) |
USD 500.00 |
|
MR203393 | Klk1b9 (Myc-DDK-tagged) - Mouse kallikrein 1-related peptidase b9 (Klk1b9) |
USD 300.00 |
|
MR203393L3 | Lenti ORF clone of Klk1b9 (Myc-DDK-tagged) - Mouse kallikrein 1-related peptidase b9 (Klk1b9) |
USD 600.00 |
|
MR203393L4 | Lenti ORF clone of Klk1b9 (mGFP-tagged) - Mouse kallikrein 1-related peptidase b9 (Klk1b9) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review