Brcc3 (NM_145956) Mouse Untagged Clone

CAT#: MC204038

Brcc3 (untagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2, (10ug)


  "NM_145956" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Brcc3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Brcc3
Synonyms C6.1A
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021313
CCACGCGTCCGCGGACGCGTGGGGTGAGCGGAAAGAAGATGGCGGTGCAGGTGGTGCAAGCTGTGCAGGC GGTTCATCTTGAGTCTGACGCTTTCCTAGTTTGTCTCAACCATGCTCTGAGCACAGAAAAGGAGGAAGTG ATGGGTCTGTGTATAGGGGAGTTGAATGATGACATAAGGAGTGACTCCAAATTTACATACACTGGAACGG AAATGCGCACAGTCCAAGAAAAGATGGATACCATCAGAATTGTTCATATCCATTCTGTCATCATCTTGCG GCGTTCTGACAAGAGAAAGGACCGTGTAGAAATTTCTCCAGAGCAGCTGTCTGCAGCTTCAACAGAGGCA GAAAGGTTGGCTGAACTAACAGGTCGTCCCATGAGAGTTGTTGGCTGGTATCATTCCCACCCTCATATAA CTGTTTGGCCTTCACATGTTGATGTTCGTACACAAGCCATGTACCAAATGATGGATCAAGGCTTTGTAGG ACTTATTTTTTCCTGTTTCATAGAAGACAAAAACACAAAGACTGGCCGGGTACTCTATACTTGCTTCCAA TCCATACAAGCCCAAAAAAGCTCAGAGTATGAGAGAATTGAAATCCCAATCCATATTGTACCTCATATCA CTATTGGGAAAGTATGCCTTGAATCTGCAGTAGAGCTGCCAAAAATCCTGTGTCAGGAAGAACAGGATGC ATATAGAAGGATTCACAGCCTTACACATCTGGACTCAGTGACCAAGATCCATAATGGCTCAGTATTTACC AAGAATTTGTGCAGTCAGATGTCAGCAGTCAGTGGGCCTCTACTGCAGTGGTTGGAAGACAGATTGGAGC AAAACCAGCAGCATTTGCAGGAGTTGCAACAAGAAAAGGAAGAGCTTATGGAAGAGCTGTCTTCCCTAGA ATAAAGCATGAGAACAACAAAAAAATGTGGGCAGATGAAAATACCTGGCATATAATTTATTATATTAAAT CAATTTTGAAAAAGATAATGTTGGAGGGACTACATTATATAACTTCAAGACTTATTATAAAGCTACAATA ATCAAGATACTATGTTTTTTGCAGAAGAATCAATGCAATAGGAAAGAAAATTCAGAAATAAGCCCACAAT AATATGCTTAACTAATTTTGAAAAAGTAAAAATGTGATTCAAGGAAGAAAAAACAGTCATTTCAACGCAT TGAACCTCCACAAGCCAACAAAGTATATTCTAAAAGTACCTCCAAATATATCATGCATTTAAATGTACTA TGAAAAACCTAGAAAAAATATTCAAGAAAAATTTTCAGGAGTTAAGTACTTAATATTCAACTCAAAAGCA CAATTTCATAAGAAAACAAAGTAGATTTATTGGACTTCATCAAAATTAAAGCTTTCTATTCTGCAAAACT AAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_145956
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021313, AAH21313
RefSeq Size 1416 bp
RefSeq ORF 876 bp
Locus ID 210766
UniProt ID P46737
Cytogenetics X A7.3
Gene Summary Metalloprotease that specifically cleaves 'Lys-63'-linked polyubiquitin chains. Does not have activity toward 'Lys-48'-linked polyubiquitin chains. Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). In the BRCA1-A complex, it specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX, antagonizing the RNF8-dependent ubiquitination at double-strand breaks (DSBs). Catalytic subunit of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates. Mediates the specific 'Lys-63'-specific deubiquitination associated with the COP9 signalosome complex (CSN), via the interaction of the BRISC complex with the CSN complex. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1. Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression. Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.