Srp14 (NM_009273) Mouse Untagged Clone

CAT#: MC203991

Srp14 (untagged) - Mouse signal recognition particle 14 (Srp14), (10ug)


  "NM_009273" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Srp14"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Srp14
Synonyms 14kDa; AW536328
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021537
CCACGCGTCCGAACCGCTGGAGGCTTCTGCTGACGGCGTCGGACCTGCGGAGCCCAGGATGGTGTTGCTC GAGAGCGAGCAGTTCCTGACGGAGCTGACCAGGCTCTTCCAGAAGTGCCGCTCGTCGGGCAGCGTGTTCA TCACCCTCAAGAAATATGACGGTCGCACCAAACCTATCCCGAGGAAGAGTTCTGTGGAGGGCCTCGAGCC TGCAGAAAACAAGTGTCTGTTGAGAGCCACGGATGGGAAAAGGAAGATCAGCACCGTGGTGAGCTCCAAA GAAGTGAACAAGTTTCAGATGGCCTATTCAAATCTACTGAGAGCCAACATGGACGGGCTGAAGAAGAGGG ACAAGAAGAACAAGAGTAAGAAGAGCAAACCAGCACAGTGACAGGCGTGGCTGCTACCAACCAGCTGCAC AAGTGCATTTTTCCTCTGTTTGCTGCTTTCAGCACCTCTGTATGTAACTGTTTCCACGGAAGGGTCCTTT AAGAGAGAAGGACTGGGATGGGCATGGGCTAGTTGTGGTAAGACGCCAGTTTTTGATTTGTGCTGTGTGG CTGGATATTCTTAGATTCCAGCCGTAAGGTTTCTAGTCATCTTTGAGGAGCTATGCATCATTAATCTCCA GGCTAGCTGCTTTTTTTCCTACCCTATTTATGACAGTAACTACTAACTCTAGATGGTACAGTTACTCAAG TGATTTTTACCTTGTCATGAGATTACTGTAATAGTTTTATTAAAAGTTGTGTTATCCTAAAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009273
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021537, AAH21537
RefSeq Size 775 bp
RefSeq ORF 333 bp
Locus ID 20813
UniProt ID P16254
Cytogenetics 2 E5
Gene Summary Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.