Srp14 (NM_009273) Mouse Untagged Clone
CAT#: MC203991
Srp14 (untagged) - Mouse signal recognition particle 14 (Srp14), (10ug)
"NM_009273" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Srp14 |
Synonyms | 14kDa; AW536328 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021537
CCACGCGTCCGAACCGCTGGAGGCTTCTGCTGACGGCGTCGGACCTGCGGAGCCCAGGATGGTGTTGCTC GAGAGCGAGCAGTTCCTGACGGAGCTGACCAGGCTCTTCCAGAAGTGCCGCTCGTCGGGCAGCGTGTTCA TCACCCTCAAGAAATATGACGGTCGCACCAAACCTATCCCGAGGAAGAGTTCTGTGGAGGGCCTCGAGCC TGCAGAAAACAAGTGTCTGTTGAGAGCCACGGATGGGAAAAGGAAGATCAGCACCGTGGTGAGCTCCAAA GAAGTGAACAAGTTTCAGATGGCCTATTCAAATCTACTGAGAGCCAACATGGACGGGCTGAAGAAGAGGG ACAAGAAGAACAAGAGTAAGAAGAGCAAACCAGCACAGTGACAGGCGTGGCTGCTACCAACCAGCTGCAC AAGTGCATTTTTCCTCTGTTTGCTGCTTTCAGCACCTCTGTATGTAACTGTTTCCACGGAAGGGTCCTTT AAGAGAGAAGGACTGGGATGGGCATGGGCTAGTTGTGGTAAGACGCCAGTTTTTGATTTGTGCTGTGTGG CTGGATATTCTTAGATTCCAGCCGTAAGGTTTCTAGTCATCTTTGAGGAGCTATGCATCATTAATCTCCA GGCTAGCTGCTTTTTTTCCTACCCTATTTATGACAGTAACTACTAACTCTAGATGGTACAGTTACTCAAG TGATTTTTACCTTGTCATGAGATTACTGTAATAGTTTTATTAAAAGTTGTGTTATCCTAAAAAAAAAAAA AAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009273 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021537, AAH21537 |
RefSeq Size | 775 bp |
RefSeq ORF | 333 bp |
Locus ID | 20813 |
UniProt ID | P16254 |
Cytogenetics | 2 E5 |
Gene Summary | Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200415 | Srp14 (tGFP-tagged) - Mouse signal recognition particle 14 (Srp14) |
USD 350.00 |
|
MR200415 | Srp14 (Myc-DDK-tagged) - Mouse signal recognition particle 14 (Srp14) |
USD 150.00 |
|
MR200415L3 | Lenti ORF clone of Srp14 (Myc-DDK-tagged) - Mouse signal recognition particle 14 (Srp14) |
USD 450.00 |
|
MR200415L4 | Lenti ORF clone of Srp14 (mGFP-tagged) - Mouse signal recognition particle 14 (Srp14) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review