Zcchc18 (NM_025893) Mouse Untagged Clone

CAT#: MC203952

Zcchc18 (untagged) - Mouse zinc finger, CCHC domain containing 18 (Zcchc18), transcript variant 3, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zcchc18 (NM_025893) Mouse Untagged Clone
Symbol Zcchc18
Synonyms 1500031H04Rik; Sizn2
Vector pCMV6-Kan/Neo
Sequence Data
>BC017627
GCCTAACCCAGACAGCTCTGAGGCTGAGGCGCCATCCTTTCCTCTGCAAGGCCTACGAGGTGAGACAGCT CTTCGCAGCAGACCCTGAGCATCCTCTGCTCATCTACGAAGCAGCTCATCAAAGCCGATTTCAAACGTGA ATTCTGTGTGACTGATTGCAGAGCTGTTTAGACTAGAGGCCCAGGGCACCTGGATCGGAGAGCCTGCGGT CAGAGATCAATCCTACCCGGACAAGAGCTATTGCGGAAAGCACCTGTTGCAGAGAGTAGGCTTGAAATAA AGGTGGAAGCCAGTTTCTGAGCTCTGTTTCTACCCAAACACAAGGAAGAGACTGCTGGGGAACGTTCCTT TGGAGGTTTCTGCAGATTGGACTGCTTTTGTTTGCAGAAAGTCCAGGCGTCTTGTATTCAGATATCCAAT TGTTGTCAGGCATGGCTAGCCTCCTTGCTAGGATGGGTAACAGTCGCCGGCAGAATGCAGCTTTTATGCC TTTTGCCCATTCCATGCTGAGGGCCCTGGGGAGGAGCCTTGGTCCTTTGATTGCCAACATTGCAGAGAGA AACATACAGTCGTTCTCTGGGAGGGCAGAGCTAGGACCCGGGGAAGAAACCTTTGAAAACTGGCTAAGCC AAGTCCATGAGGTCCTGCCAGATTGGCCTATGTCTGAAGAAGAAAAGATCAAGCGCCTGATGAGAACCCT TAGGGGCCCTGCCCGGGAGGCCATGCGTTTGTTCCAGGCTGACAATCCCAATCTAAATGTCGCAGAATTT TTGCGGGCAATGAAGCTGCTCTTTGGAGCGTCTGAGAGCAGTATAACAGCGCATGGCAAATTTTTAAGCA CCCTGCAGGCACAGGGAGAGAAACCATCCCTGTATGTGATCCGTTTAGAGGTGCAGCTACAGAATGCTAT CCAGGCAGGGGTCCTTCCTCAGAGCGAGGCAAACAGGACTCGCCTGCACCAGCTCCTTGTAGGGGCTGAG CTGAGTAGGGAGCTGCGCACCAAGCTTAAGGGGCTTCTCCAAATGCATGCGCATAATGAGCAGGAAAACC TTCCTGACTTCCTGGAGTTGATCAGGATGATAAGGGAGGAAGAGGATTGGGATGAGACATTCCTTAGAAA TAAGCGGCCCAGAAGATCTGAGACAGTGATGGAGCGGGCAGCCAGCCCTGTGGTCTTTCAAGGCTCCCTG CCTATAGTGATAGGCAGTGCCGACTGTAATGTGATAGAGATAGATGATTCCCAGGATGATTCAGATGAAG ATGTGATCCTGGTGGAGCCCGAGGACCCTCCACTCTCATCCCCAGGTGCCTCATCCCTCCGAGGCACAGC CAGTACTCAGGAAGAGATGCTGATTATTGAGTCCCCTGATGATTTTGATGAGGAGTCTCCTTCCACTAGC AGTGGTTCTGGGCAAAGGAATAACGGGCCTGGGGATCTAGGTAGAACCAGAAAGCGCAAGTACCCAATCC GCTGTCCTCATTGTGGTGAAGAGGGCCACGCCAAAGAAACCTGTGACAATACCAGCAACAAGGGCCAGGT TTTTGAGAATTTGATAGTCACTCTGCAGGAGCTGACTCACATGGAGAGACCCAAACCCTCTGTACCATAC TAAGGTGTGACCCTCGGCCCCAGATCAGTGTTTGAATCTCCTCAGAAGCTAATTCTGGAGGAAAAAGGGA TGGGGTGGGCTGCTGACATTAAGGAATTCATTTAAAACAAGCTTTTTCTTTGGAGAAGAAAAAGCAAACT GGGGTACCATGCAACAGAGAGGCATGGGCCCACATCATTCCTTGCTCATTCCATTAACTGCTTAATGGTT GTTTCTCTGTGTGTCTTTCTCTGGTGATTTTAATCTATCCGTGAAGTGGTACCTTTTTGAACCTTCCAAA TGAAATTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_025893
ORF Size 1182 bp
Insert Size 1182
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC017627, NP_080169
RefSeq Size 1912
RefSeq ORF 1182
Locus ID 66995
Cytogenetics X|X F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.